ID: 1032080738

View in Genome Browser
Species Human (GRCh38)
Location 7:128857258-128857280
Sequence ATGGCAATGAGGTAGTTGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 2, 1: 0, 2: 0, 3: 11, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032080738_1032080743 6 Left 1032080738 7:128857258-128857280 CCTGGCAACTACCTCATTGCCAT 0: 2
1: 0
2: 0
3: 11
4: 148
Right 1032080743 7:128857287-128857309 CGGTGGCCCCCAGCACATCGTGG 0: 2
1: 0
2: 0
3: 12
4: 83
1032080738_1032080744 7 Left 1032080738 7:128857258-128857280 CCTGGCAACTACCTCATTGCCAT 0: 2
1: 0
2: 0
3: 11
4: 148
Right 1032080744 7:128857288-128857310 GGTGGCCCCCAGCACATCGTGGG 0: 2
1: 0
2: 1
3: 6
4: 92
1032080738_1032080750 27 Left 1032080738 7:128857258-128857280 CCTGGCAACTACCTCATTGCCAT 0: 2
1: 0
2: 0
3: 11
4: 148
Right 1032080750 7:128857308-128857330 GGGCAGCCCCTTCAAGGCCAAGG 0: 2
1: 1
2: 6
3: 31
4: 283
1032080738_1032080749 21 Left 1032080738 7:128857258-128857280 CCTGGCAACTACCTCATTGCCAT 0: 2
1: 0
2: 0
3: 11
4: 148
Right 1032080749 7:128857302-128857324 CATCGTGGGCAGCCCCTTCAAGG 0: 2
1: 1
2: 1
3: 14
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032080738 Original CRISPR ATGGCAATGAGGTAGTTGCC AGG (reversed) Exonic