ID: 1032080740

View in Genome Browser
Species Human (GRCh38)
Location 7:128857269-128857291
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 2, 1: 0, 2: 0, 3: 3, 4: 50}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032080740_1032080749 10 Left 1032080740 7:128857269-128857291 CCTCATTGCCATCAAGTACGGTG 0: 2
1: 0
2: 0
3: 3
4: 50
Right 1032080749 7:128857302-128857324 CATCGTGGGCAGCCCCTTCAAGG 0: 2
1: 1
2: 1
3: 14
4: 107
1032080740_1032080753 23 Left 1032080740 7:128857269-128857291 CCTCATTGCCATCAAGTACGGTG 0: 2
1: 0
2: 0
3: 3
4: 50
Right 1032080753 7:128857315-128857337 CCCTTCAAGGCCAAGGTCACTGG 0: 2
1: 2
2: 4
3: 25
4: 185
1032080740_1032080743 -5 Left 1032080740 7:128857269-128857291 CCTCATTGCCATCAAGTACGGTG 0: 2
1: 0
2: 0
3: 3
4: 50
Right 1032080743 7:128857287-128857309 CGGTGGCCCCCAGCACATCGTGG 0: 2
1: 0
2: 0
3: 12
4: 83
1032080740_1032080750 16 Left 1032080740 7:128857269-128857291 CCTCATTGCCATCAAGTACGGTG 0: 2
1: 0
2: 0
3: 3
4: 50
Right 1032080750 7:128857308-128857330 GGGCAGCCCCTTCAAGGCCAAGG 0: 2
1: 1
2: 6
3: 31
4: 283
1032080740_1032080744 -4 Left 1032080740 7:128857269-128857291 CCTCATTGCCATCAAGTACGGTG 0: 2
1: 0
2: 0
3: 3
4: 50
Right 1032080744 7:128857288-128857310 GGTGGCCCCCAGCACATCGTGGG 0: 2
1: 0
2: 1
3: 6
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032080740 Original CRISPR CACCGTACTTGATGGCAATG AGG (reversed) Exonic