ID: 1032080741

View in Genome Browser
Species Human (GRCh38)
Location 7:128857270-128857292
Sequence CTCATTGCCATCAAGTACGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 2, 1: 0, 2: 2, 3: 3, 4: 37}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032080731_1032080741 17 Left 1032080731 7:128857230-128857252 CCATGTGGTCACTTATACTCCCA 0: 1
1: 0
2: 0
3: 10
4: 119
Right 1032080741 7:128857270-128857292 CTCATTGCCATCAAGTACGGTGG 0: 2
1: 0
2: 2
3: 3
4: 37
1032080734_1032080741 -2 Left 1032080734 7:128857249-128857271 CCCATGGCCCCTGGCAACTACCT 0: 2
1: 0
2: 5
3: 31
4: 406
Right 1032080741 7:128857270-128857292 CTCATTGCCATCAAGTACGGTGG 0: 2
1: 0
2: 2
3: 3
4: 37
1032080730_1032080741 25 Left 1032080730 7:128857222-128857244 CCTGAGGGCCATGTGGTCACTTA 0: 1
1: 0
2: 1
3: 13
4: 107
Right 1032080741 7:128857270-128857292 CTCATTGCCATCAAGTACGGTGG 0: 2
1: 0
2: 2
3: 3
4: 37
1032080735_1032080741 -3 Left 1032080735 7:128857250-128857272 CCATGGCCCCTGGCAACTACCTC 0: 2
1: 0
2: 4
3: 61
4: 545
Right 1032080741 7:128857270-128857292 CTCATTGCCATCAAGTACGGTGG 0: 2
1: 0
2: 2
3: 3
4: 37
1032080737_1032080741 -10 Left 1032080737 7:128857257-128857279 CCCTGGCAACTACCTCATTGCCA 0: 2
1: 0
2: 0
3: 15
4: 168
Right 1032080741 7:128857270-128857292 CTCATTGCCATCAAGTACGGTGG 0: 2
1: 0
2: 2
3: 3
4: 37
1032080736_1032080741 -9 Left 1032080736 7:128857256-128857278 CCCCTGGCAACTACCTCATTGCC 0: 2
1: 0
2: 0
3: 9
4: 189
Right 1032080741 7:128857270-128857292 CTCATTGCCATCAAGTACGGTGG 0: 2
1: 0
2: 2
3: 3
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032080741 Original CRISPR CTCATTGCCATCAAGTACGG TGG Exonic