ID: 1032080742

View in Genome Browser
Species Human (GRCh38)
Location 7:128857277-128857299
Sequence CTGGGGGCCACCGTACTTGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 2, 1: 0, 2: 0, 3: 3, 4: 76}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032080742_1032080756 30 Left 1032080742 7:128857277-128857299 CCATCAAGTACGGTGGCCCCCAG 0: 2
1: 0
2: 0
3: 3
4: 76
Right 1032080756 7:128857330-128857352 GTCACTGGTGAGTGCCAGTTTGG 0: 1
1: 1
2: 2
3: 7
4: 96
1032080742_1032080749 2 Left 1032080742 7:128857277-128857299 CCATCAAGTACGGTGGCCCCCAG 0: 2
1: 0
2: 0
3: 3
4: 76
Right 1032080749 7:128857302-128857324 CATCGTGGGCAGCCCCTTCAAGG 0: 2
1: 1
2: 1
3: 14
4: 107
1032080742_1032080750 8 Left 1032080742 7:128857277-128857299 CCATCAAGTACGGTGGCCCCCAG 0: 2
1: 0
2: 0
3: 3
4: 76
Right 1032080750 7:128857308-128857330 GGGCAGCCCCTTCAAGGCCAAGG 0: 2
1: 1
2: 6
3: 31
4: 283
1032080742_1032080753 15 Left 1032080742 7:128857277-128857299 CCATCAAGTACGGTGGCCCCCAG 0: 2
1: 0
2: 0
3: 3
4: 76
Right 1032080753 7:128857315-128857337 CCCTTCAAGGCCAAGGTCACTGG 0: 2
1: 2
2: 4
3: 25
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032080742 Original CRISPR CTGGGGGCCACCGTACTTGA TGG (reversed) Exonic