ID: 1032080744

View in Genome Browser
Species Human (GRCh38)
Location 7:128857288-128857310
Sequence GGTGGCCCCCAGCACATCGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 2, 1: 0, 2: 1, 3: 6, 4: 92}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032080735_1032080744 15 Left 1032080735 7:128857250-128857272 CCATGGCCCCTGGCAACTACCTC 0: 2
1: 0
2: 4
3: 61
4: 545
Right 1032080744 7:128857288-128857310 GGTGGCCCCCAGCACATCGTGGG 0: 2
1: 0
2: 1
3: 6
4: 92
1032080738_1032080744 7 Left 1032080738 7:128857258-128857280 CCTGGCAACTACCTCATTGCCAT 0: 2
1: 0
2: 0
3: 11
4: 148
Right 1032080744 7:128857288-128857310 GGTGGCCCCCAGCACATCGTGGG 0: 2
1: 0
2: 1
3: 6
4: 92
1032080734_1032080744 16 Left 1032080734 7:128857249-128857271 CCCATGGCCCCTGGCAACTACCT 0: 2
1: 0
2: 5
3: 31
4: 406
Right 1032080744 7:128857288-128857310 GGTGGCCCCCAGCACATCGTGGG 0: 2
1: 0
2: 1
3: 6
4: 92
1032080736_1032080744 9 Left 1032080736 7:128857256-128857278 CCCCTGGCAACTACCTCATTGCC 0: 2
1: 0
2: 0
3: 9
4: 189
Right 1032080744 7:128857288-128857310 GGTGGCCCCCAGCACATCGTGGG 0: 2
1: 0
2: 1
3: 6
4: 92
1032080737_1032080744 8 Left 1032080737 7:128857257-128857279 CCCTGGCAACTACCTCATTGCCA 0: 2
1: 0
2: 0
3: 15
4: 168
Right 1032080744 7:128857288-128857310 GGTGGCCCCCAGCACATCGTGGG 0: 2
1: 0
2: 1
3: 6
4: 92
1032080740_1032080744 -4 Left 1032080740 7:128857269-128857291 CCTCATTGCCATCAAGTACGGTG 0: 2
1: 0
2: 0
3: 3
4: 50
Right 1032080744 7:128857288-128857310 GGTGGCCCCCAGCACATCGTGGG 0: 2
1: 0
2: 1
3: 6
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032080744 Original CRISPR GGTGGCCCCCAGCACATCGT GGG Exonic