ID: 1032080749

View in Genome Browser
Species Human (GRCh38)
Location 7:128857302-128857324
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 2, 1: 1, 2: 1, 3: 14, 4: 107}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032080740_1032080749 10 Left 1032080740 7:128857269-128857291 CCTCATTGCCATCAAGTACGGTG 0: 2
1: 0
2: 0
3: 3
4: 50
Right 1032080749 7:128857302-128857324 CATCGTGGGCAGCCCCTTCAAGG 0: 2
1: 1
2: 1
3: 14
4: 107
1032080735_1032080749 29 Left 1032080735 7:128857250-128857272 CCATGGCCCCTGGCAACTACCTC 0: 2
1: 0
2: 4
3: 61
4: 545
Right 1032080749 7:128857302-128857324 CATCGTGGGCAGCCCCTTCAAGG 0: 2
1: 1
2: 1
3: 14
4: 107
1032080742_1032080749 2 Left 1032080742 7:128857277-128857299 CCATCAAGTACGGTGGCCCCCAG 0: 2
1: 0
2: 0
3: 3
4: 76
Right 1032080749 7:128857302-128857324 CATCGTGGGCAGCCCCTTCAAGG 0: 2
1: 1
2: 1
3: 14
4: 107
1032080734_1032080749 30 Left 1032080734 7:128857249-128857271 CCCATGGCCCCTGGCAACTACCT 0: 2
1: 0
2: 5
3: 31
4: 406
Right 1032080749 7:128857302-128857324 CATCGTGGGCAGCCCCTTCAAGG 0: 2
1: 1
2: 1
3: 14
4: 107
1032080736_1032080749 23 Left 1032080736 7:128857256-128857278 CCCCTGGCAACTACCTCATTGCC 0: 2
1: 0
2: 0
3: 9
4: 189
Right 1032080749 7:128857302-128857324 CATCGTGGGCAGCCCCTTCAAGG 0: 2
1: 1
2: 1
3: 14
4: 107
1032080737_1032080749 22 Left 1032080737 7:128857257-128857279 CCCTGGCAACTACCTCATTGCCA 0: 2
1: 0
2: 0
3: 15
4: 168
Right 1032080749 7:128857302-128857324 CATCGTGGGCAGCCCCTTCAAGG 0: 2
1: 1
2: 1
3: 14
4: 107
1032080738_1032080749 21 Left 1032080738 7:128857258-128857280 CCTGGCAACTACCTCATTGCCAT 0: 2
1: 0
2: 0
3: 11
4: 148
Right 1032080749 7:128857302-128857324 CATCGTGGGCAGCCCCTTCAAGG 0: 2
1: 1
2: 1
3: 14
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type