ID: 1032080750

View in Genome Browser
Species Human (GRCh38)
Location 7:128857308-128857330
Sequence GGGCAGCCCCTTCAAGGCCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 2, 1: 1, 2: 6, 3: 31, 4: 283}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032080738_1032080750 27 Left 1032080738 7:128857258-128857280 CCTGGCAACTACCTCATTGCCAT 0: 2
1: 0
2: 0
3: 11
4: 148
Right 1032080750 7:128857308-128857330 GGGCAGCCCCTTCAAGGCCAAGG 0: 2
1: 1
2: 6
3: 31
4: 283
1032080737_1032080750 28 Left 1032080737 7:128857257-128857279 CCCTGGCAACTACCTCATTGCCA 0: 2
1: 0
2: 0
3: 15
4: 168
Right 1032080750 7:128857308-128857330 GGGCAGCCCCTTCAAGGCCAAGG 0: 2
1: 1
2: 6
3: 31
4: 283
1032080747_1032080750 -10 Left 1032080747 7:128857295-128857317 CCCAGCACATCGTGGGCAGCCCC 0: 2
1: 0
2: 1
3: 12
4: 132
Right 1032080750 7:128857308-128857330 GGGCAGCCCCTTCAAGGCCAAGG 0: 2
1: 1
2: 6
3: 31
4: 283
1032080736_1032080750 29 Left 1032080736 7:128857256-128857278 CCCCTGGCAACTACCTCATTGCC 0: 2
1: 0
2: 0
3: 9
4: 189
Right 1032080750 7:128857308-128857330 GGGCAGCCCCTTCAAGGCCAAGG 0: 2
1: 1
2: 6
3: 31
4: 283
1032080740_1032080750 16 Left 1032080740 7:128857269-128857291 CCTCATTGCCATCAAGTACGGTG 0: 2
1: 0
2: 0
3: 3
4: 50
Right 1032080750 7:128857308-128857330 GGGCAGCCCCTTCAAGGCCAAGG 0: 2
1: 1
2: 6
3: 31
4: 283
1032080746_1032080750 -9 Left 1032080746 7:128857294-128857316 CCCCAGCACATCGTGGGCAGCCC 0: 2
1: 0
2: 0
3: 11
4: 153
Right 1032080750 7:128857308-128857330 GGGCAGCCCCTTCAAGGCCAAGG 0: 2
1: 1
2: 6
3: 31
4: 283
1032080745_1032080750 -8 Left 1032080745 7:128857293-128857315 CCCCCAGCACATCGTGGGCAGCC 0: 2
1: 0
2: 0
3: 11
4: 109
Right 1032080750 7:128857308-128857330 GGGCAGCCCCTTCAAGGCCAAGG 0: 2
1: 1
2: 6
3: 31
4: 283
1032080742_1032080750 8 Left 1032080742 7:128857277-128857299 CCATCAAGTACGGTGGCCCCCAG 0: 2
1: 0
2: 0
3: 3
4: 76
Right 1032080750 7:128857308-128857330 GGGCAGCCCCTTCAAGGCCAAGG 0: 2
1: 1
2: 6
3: 31
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032080750 Original CRISPR GGGCAGCCCCTTCAAGGCCA AGG Exonic