ID: 1032080753

View in Genome Browser
Species Human (GRCh38)
Location 7:128857315-128857337
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 2, 1: 2, 2: 4, 3: 25, 4: 185}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032080746_1032080753 -2 Left 1032080746 7:128857294-128857316 CCCCAGCACATCGTGGGCAGCCC 0: 2
1: 0
2: 0
3: 11
4: 153
Right 1032080753 7:128857315-128857337 CCCTTCAAGGCCAAGGTCACTGG 0: 2
1: 2
2: 4
3: 25
4: 185
1032080747_1032080753 -3 Left 1032080747 7:128857295-128857317 CCCAGCACATCGTGGGCAGCCCC 0: 2
1: 0
2: 1
3: 12
4: 132
Right 1032080753 7:128857315-128857337 CCCTTCAAGGCCAAGGTCACTGG 0: 2
1: 2
2: 4
3: 25
4: 185
1032080740_1032080753 23 Left 1032080740 7:128857269-128857291 CCTCATTGCCATCAAGTACGGTG 0: 2
1: 0
2: 0
3: 3
4: 50
Right 1032080753 7:128857315-128857337 CCCTTCAAGGCCAAGGTCACTGG 0: 2
1: 2
2: 4
3: 25
4: 185
1032080748_1032080753 -4 Left 1032080748 7:128857296-128857318 CCAGCACATCGTGGGCAGCCCCT 0: 2
1: 0
2: 0
3: 12
4: 165
Right 1032080753 7:128857315-128857337 CCCTTCAAGGCCAAGGTCACTGG 0: 2
1: 2
2: 4
3: 25
4: 185
1032080745_1032080753 -1 Left 1032080745 7:128857293-128857315 CCCCCAGCACATCGTGGGCAGCC 0: 2
1: 0
2: 0
3: 11
4: 109
Right 1032080753 7:128857315-128857337 CCCTTCAAGGCCAAGGTCACTGG 0: 2
1: 2
2: 4
3: 25
4: 185
1032080742_1032080753 15 Left 1032080742 7:128857277-128857299 CCATCAAGTACGGTGGCCCCCAG 0: 2
1: 0
2: 0
3: 3
4: 76
Right 1032080753 7:128857315-128857337 CCCTTCAAGGCCAAGGTCACTGG 0: 2
1: 2
2: 4
3: 25
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type