ID: 1032080756

View in Genome Browser
Species Human (GRCh38)
Location 7:128857330-128857352
Sequence GTCACTGGTGAGTGCCAGTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 1, 2: 2, 3: 7, 4: 96}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032080742_1032080756 30 Left 1032080742 7:128857277-128857299 CCATCAAGTACGGTGGCCCCCAG 0: 2
1: 0
2: 0
3: 3
4: 76
Right 1032080756 7:128857330-128857352 GTCACTGGTGAGTGCCAGTTTGG 0: 1
1: 1
2: 2
3: 7
4: 96
1032080751_1032080756 -7 Left 1032080751 7:128857314-128857336 CCCCTTCAAGGCCAAGGTCACTG 0: 2
1: 0
2: 3
3: 12
4: 241
Right 1032080756 7:128857330-128857352 GTCACTGGTGAGTGCCAGTTTGG 0: 1
1: 1
2: 2
3: 7
4: 96
1032080746_1032080756 13 Left 1032080746 7:128857294-128857316 CCCCAGCACATCGTGGGCAGCCC 0: 2
1: 0
2: 0
3: 11
4: 153
Right 1032080756 7:128857330-128857352 GTCACTGGTGAGTGCCAGTTTGG 0: 1
1: 1
2: 2
3: 7
4: 96
1032080754_1032080756 -9 Left 1032080754 7:128857316-128857338 CCTTCAAGGCCAAGGTCACTGGT 0: 2
1: 0
2: 3
3: 18
4: 172
Right 1032080756 7:128857330-128857352 GTCACTGGTGAGTGCCAGTTTGG 0: 1
1: 1
2: 2
3: 7
4: 96
1032080748_1032080756 11 Left 1032080748 7:128857296-128857318 CCAGCACATCGTGGGCAGCCCCT 0: 2
1: 0
2: 0
3: 12
4: 165
Right 1032080756 7:128857330-128857352 GTCACTGGTGAGTGCCAGTTTGG 0: 1
1: 1
2: 2
3: 7
4: 96
1032080745_1032080756 14 Left 1032080745 7:128857293-128857315 CCCCCAGCACATCGTGGGCAGCC 0: 2
1: 0
2: 0
3: 11
4: 109
Right 1032080756 7:128857330-128857352 GTCACTGGTGAGTGCCAGTTTGG 0: 1
1: 1
2: 2
3: 7
4: 96
1032080747_1032080756 12 Left 1032080747 7:128857295-128857317 CCCAGCACATCGTGGGCAGCCCC 0: 2
1: 0
2: 1
3: 12
4: 132
Right 1032080756 7:128857330-128857352 GTCACTGGTGAGTGCCAGTTTGG 0: 1
1: 1
2: 2
3: 7
4: 96
1032080752_1032080756 -8 Left 1032080752 7:128857315-128857337 CCCTTCAAGGCCAAGGTCACTGG 0: 2
1: 0
2: 5
3: 15
4: 196
Right 1032080756 7:128857330-128857352 GTCACTGGTGAGTGCCAGTTTGG 0: 1
1: 1
2: 2
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032080756 Original CRISPR GTCACTGGTGAGTGCCAGTT TGG Exonic