ID: 1032081285

View in Genome Browser
Species Human (GRCh38)
Location 7:128859767-128859789
Sequence GGCTGTTGCAGGAGTTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032081285_1032081301 27 Left 1032081285 7:128859767-128859789 CCTCCTGAACTCCTGCAACAGCC No data
Right 1032081301 7:128859817-128859839 CCCTCCATGCTGCAGCTTGGCGG No data
1032081285_1032081303 28 Left 1032081285 7:128859767-128859789 CCTCCTGAACTCCTGCAACAGCC No data
Right 1032081303 7:128859818-128859840 CCTCCATGCTGCAGCTTGGCGGG No data
1032081285_1032081304 29 Left 1032081285 7:128859767-128859789 CCTCCTGAACTCCTGCAACAGCC No data
Right 1032081304 7:128859819-128859841 CTCCATGCTGCAGCTTGGCGGGG No data
1032081285_1032081305 30 Left 1032081285 7:128859767-128859789 CCTCCTGAACTCCTGCAACAGCC No data
Right 1032081305 7:128859820-128859842 TCCATGCTGCAGCTTGGCGGGGG No data
1032081285_1032081298 24 Left 1032081285 7:128859767-128859789 CCTCCTGAACTCCTGCAACAGCC No data
Right 1032081298 7:128859814-128859836 CTCCCCTCCATGCTGCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032081285 Original CRISPR GGCTGTTGCAGGAGTTCAGG AGG (reversed) Intergenic