ID: 1032081286

View in Genome Browser
Species Human (GRCh38)
Location 7:128859770-128859792
Sequence CAGGGCTGTTGCAGGAGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032081286_1032081301 24 Left 1032081286 7:128859770-128859792 CCTGAACTCCTGCAACAGCCCTG No data
Right 1032081301 7:128859817-128859839 CCCTCCATGCTGCAGCTTGGCGG No data
1032081286_1032081307 28 Left 1032081286 7:128859770-128859792 CCTGAACTCCTGCAACAGCCCTG No data
Right 1032081307 7:128859821-128859843 CCATGCTGCAGCTTGGCGGGGGG No data
1032081286_1032081304 26 Left 1032081286 7:128859770-128859792 CCTGAACTCCTGCAACAGCCCTG No data
Right 1032081304 7:128859819-128859841 CTCCATGCTGCAGCTTGGCGGGG No data
1032081286_1032081308 29 Left 1032081286 7:128859770-128859792 CCTGAACTCCTGCAACAGCCCTG No data
Right 1032081308 7:128859822-128859844 CATGCTGCAGCTTGGCGGGGGGG No data
1032081286_1032081298 21 Left 1032081286 7:128859770-128859792 CCTGAACTCCTGCAACAGCCCTG No data
Right 1032081298 7:128859814-128859836 CTCCCCTCCATGCTGCAGCTTGG No data
1032081286_1032081303 25 Left 1032081286 7:128859770-128859792 CCTGAACTCCTGCAACAGCCCTG No data
Right 1032081303 7:128859818-128859840 CCTCCATGCTGCAGCTTGGCGGG No data
1032081286_1032081305 27 Left 1032081286 7:128859770-128859792 CCTGAACTCCTGCAACAGCCCTG No data
Right 1032081305 7:128859820-128859842 TCCATGCTGCAGCTTGGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032081286 Original CRISPR CAGGGCTGTTGCAGGAGTTC AGG (reversed) Intergenic