ID: 1032081288

View in Genome Browser
Species Human (GRCh38)
Location 7:128859778-128859800
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032081288_1032081298 13 Left 1032081288 7:128859778-128859800 CCTGCAACAGCCCTGCCCTGGCC No data
Right 1032081298 7:128859814-128859836 CTCCCCTCCATGCTGCAGCTTGG No data
1032081288_1032081308 21 Left 1032081288 7:128859778-128859800 CCTGCAACAGCCCTGCCCTGGCC No data
Right 1032081308 7:128859822-128859844 CATGCTGCAGCTTGGCGGGGGGG No data
1032081288_1032081304 18 Left 1032081288 7:128859778-128859800 CCTGCAACAGCCCTGCCCTGGCC No data
Right 1032081304 7:128859819-128859841 CTCCATGCTGCAGCTTGGCGGGG No data
1032081288_1032081301 16 Left 1032081288 7:128859778-128859800 CCTGCAACAGCCCTGCCCTGGCC No data
Right 1032081301 7:128859817-128859839 CCCTCCATGCTGCAGCTTGGCGG No data
1032081288_1032081303 17 Left 1032081288 7:128859778-128859800 CCTGCAACAGCCCTGCCCTGGCC No data
Right 1032081303 7:128859818-128859840 CCTCCATGCTGCAGCTTGGCGGG No data
1032081288_1032081307 20 Left 1032081288 7:128859778-128859800 CCTGCAACAGCCCTGCCCTGGCC No data
Right 1032081307 7:128859821-128859843 CCATGCTGCAGCTTGGCGGGGGG No data
1032081288_1032081305 19 Left 1032081288 7:128859778-128859800 CCTGCAACAGCCCTGCCCTGGCC No data
Right 1032081305 7:128859820-128859842 TCCATGCTGCAGCTTGGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032081288 Original CRISPR GGCCAGGGCAGGGCTGTTGC AGG (reversed) Intergenic