ID: 1032081289

View in Genome Browser
Species Human (GRCh38)
Location 7:128859788-128859810
Sequence GGAGGGAGCTGGCCAGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032081289_1032081304 8 Left 1032081289 7:128859788-128859810 CCCTGCCCTGGCCAGCTCCCTCC No data
Right 1032081304 7:128859819-128859841 CTCCATGCTGCAGCTTGGCGGGG No data
1032081289_1032081301 6 Left 1032081289 7:128859788-128859810 CCCTGCCCTGGCCAGCTCCCTCC No data
Right 1032081301 7:128859817-128859839 CCCTCCATGCTGCAGCTTGGCGG No data
1032081289_1032081307 10 Left 1032081289 7:128859788-128859810 CCCTGCCCTGGCCAGCTCCCTCC No data
Right 1032081307 7:128859821-128859843 CCATGCTGCAGCTTGGCGGGGGG No data
1032081289_1032081308 11 Left 1032081289 7:128859788-128859810 CCCTGCCCTGGCCAGCTCCCTCC No data
Right 1032081308 7:128859822-128859844 CATGCTGCAGCTTGGCGGGGGGG No data
1032081289_1032081305 9 Left 1032081289 7:128859788-128859810 CCCTGCCCTGGCCAGCTCCCTCC No data
Right 1032081305 7:128859820-128859842 TCCATGCTGCAGCTTGGCGGGGG No data
1032081289_1032081303 7 Left 1032081289 7:128859788-128859810 CCCTGCCCTGGCCAGCTCCCTCC No data
Right 1032081303 7:128859818-128859840 CCTCCATGCTGCAGCTTGGCGGG No data
1032081289_1032081298 3 Left 1032081289 7:128859788-128859810 CCCTGCCCTGGCCAGCTCCCTCC No data
Right 1032081298 7:128859814-128859836 CTCCCCTCCATGCTGCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032081289 Original CRISPR GGAGGGAGCTGGCCAGGGCA GGG (reversed) Intergenic