ID: 1032081294

View in Genome Browser
Species Human (GRCh38)
Location 7:128859805-128859827
Sequence AGCATGGAGGGGAGGTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032081294_1032081303 -10 Left 1032081294 7:128859805-128859827 CCCTCCAACCTCCCCTCCATGCT No data
Right 1032081303 7:128859818-128859840 CCTCCATGCTGCAGCTTGGCGGG No data
1032081294_1032081307 -7 Left 1032081294 7:128859805-128859827 CCCTCCAACCTCCCCTCCATGCT No data
Right 1032081307 7:128859821-128859843 CCATGCTGCAGCTTGGCGGGGGG No data
1032081294_1032081304 -9 Left 1032081294 7:128859805-128859827 CCCTCCAACCTCCCCTCCATGCT No data
Right 1032081304 7:128859819-128859841 CTCCATGCTGCAGCTTGGCGGGG No data
1032081294_1032081308 -6 Left 1032081294 7:128859805-128859827 CCCTCCAACCTCCCCTCCATGCT No data
Right 1032081308 7:128859822-128859844 CATGCTGCAGCTTGGCGGGGGGG No data
1032081294_1032081305 -8 Left 1032081294 7:128859805-128859827 CCCTCCAACCTCCCCTCCATGCT No data
Right 1032081305 7:128859820-128859842 TCCATGCTGCAGCTTGGCGGGGG No data
1032081294_1032081309 26 Left 1032081294 7:128859805-128859827 CCCTCCAACCTCCCCTCCATGCT No data
Right 1032081309 7:128859854-128859876 AGATAGTATATGCCCCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032081294 Original CRISPR AGCATGGAGGGGAGGTTGGA GGG (reversed) Intergenic