ID: 1032081298

View in Genome Browser
Species Human (GRCh38)
Location 7:128859814-128859836
Sequence CTCCCCTCCATGCTGCAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032081290_1032081298 2 Left 1032081290 7:128859789-128859811 CCTGCCCTGGCCAGCTCCCTCCA No data
Right 1032081298 7:128859814-128859836 CTCCCCTCCATGCTGCAGCTTGG No data
1032081286_1032081298 21 Left 1032081286 7:128859770-128859792 CCTGAACTCCTGCAACAGCCCTG No data
Right 1032081298 7:128859814-128859836 CTCCCCTCCATGCTGCAGCTTGG No data
1032081293_1032081298 -8 Left 1032081293 7:128859799-128859821 CCAGCTCCCTCCAACCTCCCCTC No data
Right 1032081298 7:128859814-128859836 CTCCCCTCCATGCTGCAGCTTGG No data
1032081289_1032081298 3 Left 1032081289 7:128859788-128859810 CCCTGCCCTGGCCAGCTCCCTCC No data
Right 1032081298 7:128859814-128859836 CTCCCCTCCATGCTGCAGCTTGG No data
1032081288_1032081298 13 Left 1032081288 7:128859778-128859800 CCTGCAACAGCCCTGCCCTGGCC No data
Right 1032081298 7:128859814-128859836 CTCCCCTCCATGCTGCAGCTTGG No data
1032081291_1032081298 -2 Left 1032081291 7:128859793-128859815 CCCTGGCCAGCTCCCTCCAACCT No data
Right 1032081298 7:128859814-128859836 CTCCCCTCCATGCTGCAGCTTGG No data
1032081292_1032081298 -3 Left 1032081292 7:128859794-128859816 CCTGGCCAGCTCCCTCCAACCTC No data
Right 1032081298 7:128859814-128859836 CTCCCCTCCATGCTGCAGCTTGG No data
1032081283_1032081298 28 Left 1032081283 7:128859763-128859785 CCTCCCTCCTGAACTCCTGCAAC No data
Right 1032081298 7:128859814-128859836 CTCCCCTCCATGCTGCAGCTTGG No data
1032081285_1032081298 24 Left 1032081285 7:128859767-128859789 CCTCCTGAACTCCTGCAACAGCC No data
Right 1032081298 7:128859814-128859836 CTCCCCTCCATGCTGCAGCTTGG No data
1032081284_1032081298 25 Left 1032081284 7:128859766-128859788 CCCTCCTGAACTCCTGCAACAGC No data
Right 1032081298 7:128859814-128859836 CTCCCCTCCATGCTGCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032081298 Original CRISPR CTCCCCTCCATGCTGCAGCT TGG Intergenic