ID: 1032081305

View in Genome Browser
Species Human (GRCh38)
Location 7:128859820-128859842
Sequence TCCATGCTGCAGCTTGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032081290_1032081305 8 Left 1032081290 7:128859789-128859811 CCTGCCCTGGCCAGCTCCCTCCA No data
Right 1032081305 7:128859820-128859842 TCCATGCTGCAGCTTGGCGGGGG No data
1032081294_1032081305 -8 Left 1032081294 7:128859805-128859827 CCCTCCAACCTCCCCTCCATGCT No data
Right 1032081305 7:128859820-128859842 TCCATGCTGCAGCTTGGCGGGGG No data
1032081292_1032081305 3 Left 1032081292 7:128859794-128859816 CCTGGCCAGCTCCCTCCAACCTC No data
Right 1032081305 7:128859820-128859842 TCCATGCTGCAGCTTGGCGGGGG No data
1032081286_1032081305 27 Left 1032081286 7:128859770-128859792 CCTGAACTCCTGCAACAGCCCTG No data
Right 1032081305 7:128859820-128859842 TCCATGCTGCAGCTTGGCGGGGG No data
1032081289_1032081305 9 Left 1032081289 7:128859788-128859810 CCCTGCCCTGGCCAGCTCCCTCC No data
Right 1032081305 7:128859820-128859842 TCCATGCTGCAGCTTGGCGGGGG No data
1032081291_1032081305 4 Left 1032081291 7:128859793-128859815 CCCTGGCCAGCTCCCTCCAACCT No data
Right 1032081305 7:128859820-128859842 TCCATGCTGCAGCTTGGCGGGGG No data
1032081288_1032081305 19 Left 1032081288 7:128859778-128859800 CCTGCAACAGCCCTGCCCTGGCC No data
Right 1032081305 7:128859820-128859842 TCCATGCTGCAGCTTGGCGGGGG No data
1032081295_1032081305 -9 Left 1032081295 7:128859806-128859828 CCTCCAACCTCCCCTCCATGCTG No data
Right 1032081305 7:128859820-128859842 TCCATGCTGCAGCTTGGCGGGGG No data
1032081285_1032081305 30 Left 1032081285 7:128859767-128859789 CCTCCTGAACTCCTGCAACAGCC No data
Right 1032081305 7:128859820-128859842 TCCATGCTGCAGCTTGGCGGGGG No data
1032081293_1032081305 -2 Left 1032081293 7:128859799-128859821 CCAGCTCCCTCCAACCTCCCCTC No data
Right 1032081305 7:128859820-128859842 TCCATGCTGCAGCTTGGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032081305 Original CRISPR TCCATGCTGCAGCTTGGCGG GGG Intergenic