ID: 1032081307

View in Genome Browser
Species Human (GRCh38)
Location 7:128859821-128859843
Sequence CCATGCTGCAGCTTGGCGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032081294_1032081307 -7 Left 1032081294 7:128859805-128859827 CCCTCCAACCTCCCCTCCATGCT No data
Right 1032081307 7:128859821-128859843 CCATGCTGCAGCTTGGCGGGGGG No data
1032081293_1032081307 -1 Left 1032081293 7:128859799-128859821 CCAGCTCCCTCCAACCTCCCCTC No data
Right 1032081307 7:128859821-128859843 CCATGCTGCAGCTTGGCGGGGGG No data
1032081290_1032081307 9 Left 1032081290 7:128859789-128859811 CCTGCCCTGGCCAGCTCCCTCCA No data
Right 1032081307 7:128859821-128859843 CCATGCTGCAGCTTGGCGGGGGG No data
1032081295_1032081307 -8 Left 1032081295 7:128859806-128859828 CCTCCAACCTCCCCTCCATGCTG No data
Right 1032081307 7:128859821-128859843 CCATGCTGCAGCTTGGCGGGGGG No data
1032081291_1032081307 5 Left 1032081291 7:128859793-128859815 CCCTGGCCAGCTCCCTCCAACCT No data
Right 1032081307 7:128859821-128859843 CCATGCTGCAGCTTGGCGGGGGG No data
1032081286_1032081307 28 Left 1032081286 7:128859770-128859792 CCTGAACTCCTGCAACAGCCCTG No data
Right 1032081307 7:128859821-128859843 CCATGCTGCAGCTTGGCGGGGGG No data
1032081289_1032081307 10 Left 1032081289 7:128859788-128859810 CCCTGCCCTGGCCAGCTCCCTCC No data
Right 1032081307 7:128859821-128859843 CCATGCTGCAGCTTGGCGGGGGG No data
1032081292_1032081307 4 Left 1032081292 7:128859794-128859816 CCTGGCCAGCTCCCTCCAACCTC No data
Right 1032081307 7:128859821-128859843 CCATGCTGCAGCTTGGCGGGGGG No data
1032081288_1032081307 20 Left 1032081288 7:128859778-128859800 CCTGCAACAGCCCTGCCCTGGCC No data
Right 1032081307 7:128859821-128859843 CCATGCTGCAGCTTGGCGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032081307 Original CRISPR CCATGCTGCAGCTTGGCGGG GGG Intergenic