ID: 1032081309

View in Genome Browser
Species Human (GRCh38)
Location 7:128859854-128859876
Sequence AGATAGTATATGCCCCTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032081306_1032081309 10 Left 1032081306 7:128859821-128859843 CCATGCTGCAGCTTGGCGGGGGG No data
Right 1032081309 7:128859854-128859876 AGATAGTATATGCCCCTCTCTGG No data
1032081299_1032081309 15 Left 1032081299 7:128859816-128859838 CCCCTCCATGCTGCAGCTTGGCG No data
Right 1032081309 7:128859854-128859876 AGATAGTATATGCCCCTCTCTGG No data
1032081295_1032081309 25 Left 1032081295 7:128859806-128859828 CCTCCAACCTCCCCTCCATGCTG No data
Right 1032081309 7:128859854-128859876 AGATAGTATATGCCCCTCTCTGG No data
1032081294_1032081309 26 Left 1032081294 7:128859805-128859827 CCCTCCAACCTCCCCTCCATGCT No data
Right 1032081309 7:128859854-128859876 AGATAGTATATGCCCCTCTCTGG No data
1032081296_1032081309 22 Left 1032081296 7:128859809-128859831 CCAACCTCCCCTCCATGCTGCAG No data
Right 1032081309 7:128859854-128859876 AGATAGTATATGCCCCTCTCTGG No data
1032081300_1032081309 14 Left 1032081300 7:128859817-128859839 CCCTCCATGCTGCAGCTTGGCGG No data
Right 1032081309 7:128859854-128859876 AGATAGTATATGCCCCTCTCTGG No data
1032081297_1032081309 18 Left 1032081297 7:128859813-128859835 CCTCCCCTCCATGCTGCAGCTTG No data
Right 1032081309 7:128859854-128859876 AGATAGTATATGCCCCTCTCTGG No data
1032081302_1032081309 13 Left 1032081302 7:128859818-128859840 CCTCCATGCTGCAGCTTGGCGGG No data
Right 1032081309 7:128859854-128859876 AGATAGTATATGCCCCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032081309 Original CRISPR AGATAGTATATGCCCCTCTC TGG Intergenic