ID: 1032081884

View in Genome Browser
Species Human (GRCh38)
Location 7:128863205-128863227
Sequence GTCCCCGTTTGGGGCTCGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 43}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032081865_1032081884 24 Left 1032081865 7:128863158-128863180 CCTGAAAGTCCTTCCGCCCTTCC 0: 1
1: 1
2: 0
3: 7
4: 146
Right 1032081884 7:128863205-128863227 GTCCCCGTTTGGGGCTCGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 43
1032081871_1032081884 8 Left 1032081871 7:128863174-128863196 CCCTTCCGGAGCGGAGGCCTCCG 0: 1
1: 0
2: 1
3: 2
4: 55
Right 1032081884 7:128863205-128863227 GTCCCCGTTTGGGGCTCGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 43
1032081873_1032081884 3 Left 1032081873 7:128863179-128863201 CCGGAGCGGAGGCCTCCGCGCCC 0: 1
1: 0
2: 0
3: 22
4: 154
Right 1032081884 7:128863205-128863227 GTCCCCGTTTGGGGCTCGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 43
1032081868_1032081884 15 Left 1032081868 7:128863167-128863189 CCTTCCGCCCTTCCGGAGCGGAG 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1032081884 7:128863205-128863227 GTCCCCGTTTGGGGCTCGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 43
1032081870_1032081884 11 Left 1032081870 7:128863171-128863193 CCGCCCTTCCGGAGCGGAGGCCT 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1032081884 7:128863205-128863227 GTCCCCGTTTGGGGCTCGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 43
1032081874_1032081884 -9 Left 1032081874 7:128863191-128863213 CCTCCGCGCCCCAAGTCCCCGTT 0: 1
1: 1
2: 0
3: 12
4: 158
Right 1032081884 7:128863205-128863227 GTCCCCGTTTGGGGCTCGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 43
1032081872_1032081884 7 Left 1032081872 7:128863175-128863197 CCTTCCGGAGCGGAGGCCTCCGC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1032081884 7:128863205-128863227 GTCCCCGTTTGGGGCTCGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032081884 Original CRISPR GTCCCCGTTTGGGGCTCGGT GGG Intronic
908480300 1:64533044-64533066 GCCCCTCTTTGGGGCTCTGTTGG - Intronic
920049283 1:203153588-203153610 GTCTCCTTTTGGGGATTGGTGGG + Intronic
922766644 1:228159530-228159552 GTCTCAGTTTGGGGCTGGGAAGG - Exonic
1072680625 10:97503581-97503603 GGCCCTGTTTGGGGCTGGTTGGG + Intronic
1080569321 11:33542103-33542125 GTCCCCCTTTAGGCCCCGGTTGG - Intronic
1081677128 11:44976788-44976810 GACCCCGGCTGGGGCTGGGTCGG + Intergenic
1092409799 12:8243908-8243930 GTCCGAGTTTGGGGCCCGGGAGG + Intergenic
1105356261 13:19662856-19662878 GGCCACGTTTGGGCCTCTGTGGG + Intronic
1106248430 13:27967134-27967156 GCCCCTGTCTGGGGCGCGGTTGG - Intronic
1115648110 14:35384218-35384240 GTCCCAGGTTGGGGCTGGCTGGG - Intergenic
1125593782 15:40872010-40872032 CTCCCCGCTTGGGGCTCAGCTGG - Intergenic
1128523285 15:68389694-68389716 GTCCCCTTTTGGAGCTCACTGGG + Intronic
1128688187 15:69702790-69702812 GGCCCAGTCTGGGGCTGGGTTGG - Intergenic
1128773911 15:70304175-70304197 GCCCCCGTTTGGCGCCCAGTTGG + Intergenic
1133042777 16:3069282-3069304 GTCCCCCCGTGGGGCTCCGTAGG - Exonic
1136145452 16:28313751-28313773 AGCTCCGTTTGGGGCTGGGTGGG + Intronic
1160941250 19:1621405-1621427 GTCCCCTTCTGGGCCTGGGTGGG + Intronic
1163826973 19:19529316-19529338 GGCCACGGTTGGGGTTCGGTGGG - Intronic
1165795160 19:38515121-38515143 GCCATCGTTTGGGGCTGGGTGGG + Intronic
925146364 2:1585759-1585781 GTCTCTCCTTGGGGCTCGGTTGG - Intergenic
933727538 2:85435254-85435276 GTCCCTGTCTGGGGCACGGCGGG - Intronic
944531277 2:200670123-200670145 GTGCCCGTTTGGGGTTGGGGTGG - Intronic
947942663 2:234071912-234071934 GTCCCTTTTTGGGCCTCTGTAGG + Intronic
1179023654 21:37660846-37660868 GTCCCCGTCTGTGCCTTGGTTGG + Intronic
1182022388 22:27091700-27091722 GTCCCCTGATGGGGCTCAGTAGG - Intergenic
950039603 3:9911424-9911446 GACCCTGTTTGGGGCGGGGTGGG - Exonic
961299803 3:125915636-125915658 GTCCAGGTTTGGGGCCCGGGAGG - Intergenic
961318201 3:126054960-126054982 ATCCCCTTTTGGGGCTGGGGTGG - Intronic
961888715 3:130112437-130112459 GTCCGGGTTTGGGGCCCGGGAGG + Intronic
967981600 3:195069268-195069290 TTACCCGTTTGGGGCTCGATGGG + Exonic
968997853 4:3956344-3956366 GTCCGGGTTTGGGGCCCGGGAGG + Intergenic
969685858 4:8673731-8673753 GTCCCCCTCTGGGCCTCCGTTGG + Intergenic
969756144 4:9152311-9152333 GTCCGGGTTTGGGGCCCGGGAGG - Intergenic
984370930 4:178863673-178863695 GTCCCTGTTTGGGCCTCCTTTGG + Intergenic
1002455639 5:179344430-179344452 GTTCAGGGTTGGGGCTCGGTGGG + Intronic
1007662739 6:43496555-43496577 GCCCTGGTTTGGGGTTCGGTGGG - Intronic
1029649443 7:101880861-101880883 GTCCTGGGTTGGGGCTCTGTGGG + Intronic
1032081884 7:128863205-128863227 GTCCCCGTTTGGGGCTCGGTGGG + Intronic
1036379389 8:8227616-8227638 GTCCGGGTTTGGGGCCCGGAAGG - Intergenic
1036850169 8:12194997-12195019 GTCCAGGTTTGGGGCCCGGGAGG + Intergenic
1036871532 8:12437270-12437292 GTCCAGGTTTGGGGCCCGGGAGG + Intergenic
1038420560 8:27431493-27431515 CTCCCCGCCTGGGGCTGGGTGGG - Intronic
1060830116 9:126708419-126708441 GTTCCTGTTTGGGGCTGGGATGG - Intergenic
1197075670 X:122350158-122350180 GTCCCAGCTTGTGGCTCAGTAGG - Intergenic
1198682456 X:139197542-139197564 GCCCCAGTGTGGGGCACGGTGGG + Intronic