ID: 1032081976

View in Genome Browser
Species Human (GRCh38)
Location 7:128863786-128863808
Sequence CTGGACTGTTTGGGGGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 177}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032081976_1032081989 24 Left 1032081976 7:128863786-128863808 CCTGTTTCCCCCAAACAGTCCAG 0: 1
1: 0
2: 1
3: 19
4: 177
Right 1032081989 7:128863833-128863855 TTCCTGCTGCCTGGTGTATTAGG No data
1032081976_1032081983 -9 Left 1032081976 7:128863786-128863808 CCTGTTTCCCCCAAACAGTCCAG 0: 1
1: 0
2: 1
3: 19
4: 177
Right 1032081983 7:128863800-128863822 ACAGTCCAGCCCAGGGCTGCTGG 0: 1
1: 0
2: 8
3: 58
4: 441
1032081976_1032081987 1 Left 1032081976 7:128863786-128863808 CCTGTTTCCCCCAAACAGTCCAG 0: 1
1: 0
2: 1
3: 19
4: 177
Right 1032081987 7:128863810-128863832 CCAGGGCTGCTGGCTGAGACTGG 0: 1
1: 0
2: 2
3: 44
4: 456
1032081976_1032081988 15 Left 1032081976 7:128863786-128863808 CCTGTTTCCCCCAAACAGTCCAG 0: 1
1: 0
2: 1
3: 19
4: 177
Right 1032081988 7:128863824-128863846 TGAGACTGGTTCCTGCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032081976 Original CRISPR CTGGACTGTTTGGGGGAAAC AGG (reversed) Intronic
904753475 1:32755105-32755127 CCGCACTTGTTGGGGGAAACAGG - Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
908770664 1:67592794-67592816 CTGGACAGTGTGGGGGAGATTGG + Intergenic
909103651 1:71381641-71381663 CTGGCCTGGTTGGGGGTGACTGG - Intergenic
912272231 1:108223241-108223263 ATGGACTGTTTGAAGGAGACAGG + Intergenic
912472061 1:109912758-109912780 CAGGAATGATTGGAGGAAACTGG - Intronic
912627984 1:111222029-111222051 CTGCTGTGTGTGGGGGAAACTGG + Intronic
913973156 1:143432018-143432040 ATGGACTGTTTGGAGGGCACTGG - Intergenic
914067540 1:144257625-144257647 ATGGACTGTTTGGAGGGCACTGG - Intergenic
914111613 1:144708729-144708751 ATGGACTGTTTGGAGGGCACTGG + Intergenic
915538170 1:156550234-156550256 ATGGACTGGTTGGGGGACCCTGG - Intronic
916087826 1:161283949-161283971 CTGGAGTGTTGGGGGGAGAGAGG + Intronic
916362318 1:163984479-163984501 CTGGAATGTTTGAGGAGAACAGG + Intergenic
916541989 1:165765763-165765785 CTGGACAGTGTGGGTGAAGCAGG + Intronic
919724091 1:200870878-200870900 CAGGACTATTTTGGGCAAACTGG - Intergenic
922233410 1:223705307-223705329 CTGAACTGTACAGGGGAAACTGG + Intronic
922912880 1:229232249-229232271 CTGGACAGCTTGGGGAAAATGGG + Intergenic
923146611 1:231202920-231202942 CTGGACTGGTCAGGGGTAACTGG + Intronic
923162174 1:231323979-231324001 CTGGAGGGGGTGGGGGAAACAGG + Intergenic
923984040 1:239359572-239359594 ATGGACTGTTAGGGTGAATCTGG + Intergenic
1065644077 10:27816345-27816367 CTGTTCTGTATGAGGGAAACAGG + Intronic
1066665212 10:37776265-37776287 CTGGACTGAGTGGTGGAAAGGGG - Intergenic
1067192247 10:44081557-44081579 CTTGACTGCTTGGGGACAACAGG + Intergenic
1068408763 10:56627132-56627154 CTGGACTGTTTGGGTGATTTCGG + Intergenic
1069658596 10:70108549-70108571 CTGGACTGTCTGGGTGAGCCTGG - Intronic
1071491584 10:86140054-86140076 CTGGAAAGTTCGGGAGAAACAGG - Intronic
1072489729 10:95892755-95892777 CTGGACTGCTTAGGGCAAACCGG - Intronic
1073323953 10:102631841-102631863 CTGGAGTATTTGGGAGAGACTGG + Exonic
1074011109 10:109481014-109481036 CTGGACTGTGTGGGCTAAATGGG - Intergenic
1074437390 10:113445679-113445701 CTGGACGGTTAGGGGGAAAAAGG + Intergenic
1076437535 10:130456295-130456317 CTGGACTGTTTTGGGAAAGCAGG + Intergenic
1077071944 11:678818-678840 TTGGACTGTTGGGGAGAAAAAGG + Exonic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1080001970 11:27360608-27360630 CTGGACAGCTTGGGGGTGACAGG - Intronic
1080572714 11:33570579-33570601 GTGAATTTTTTGGGGGAAACTGG - Intronic
1081367514 11:42254006-42254028 CTGGACTATTCTGGGCAAACTGG - Intergenic
1084456947 11:69273415-69273437 CTGGGCTGTCTGGGGCAACCAGG - Intergenic
1084966926 11:72749903-72749925 CTGGCCTCTCTGGGGGAAAGGGG - Intronic
1087904527 11:103680289-103680311 CTGGATGGTTTGGGGGACACAGG + Intergenic
1090413406 11:126524384-126524406 CTGGACCCTTTGGGGTTAACAGG + Intronic
1095889557 12:47222956-47222978 CAGAACTGTTTGGGGCAAATAGG + Intronic
1096013504 12:48244334-48244356 CTGGAATGTTTTAGGAAAACTGG - Intergenic
1096596538 12:52699488-52699510 CAGGAGTGTTTTGGGGAACCTGG - Intronic
1096947203 12:55420131-55420153 CTGCAGAGTTTGGGGGAAATGGG + Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1101653072 12:106695117-106695139 CAGGATTGATTTGGGGAAACAGG + Intronic
1108688125 13:52838552-52838574 CTGGAGTGTTTGGAGGATGCAGG - Intergenic
1110243751 13:73298021-73298043 CAGGAGTGTTCTGGGGAAACTGG + Intergenic
1110607340 13:77448149-77448171 CATGACTGTTTGGGGGAAACAGG + Intergenic
1112384874 13:98930367-98930389 CTGCACTGGATGGGAGAAACTGG - Intronic
1114329537 14:21622443-21622465 CTGGATGGTTTGGAGGAGACAGG + Intergenic
1114862225 14:26538170-26538192 CTTGATTGTTTGGGGGATATTGG - Intronic
1115402545 14:32978574-32978596 CTAGACTCTTTGGAGGAAACTGG + Intronic
1116098749 14:40407288-40407310 CTAAACTCTTTGGGGGTAACTGG + Intergenic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1116961348 14:50971452-50971474 CTGGACAGGTTTGGGGAAATAGG + Intergenic
1120349229 14:83331144-83331166 TTAGACTCTTTGTGGGAAACTGG - Intergenic
1121176313 14:91893068-91893090 CTGGAGTGGTAGGGGGAGACCGG - Intronic
1121340767 14:93103799-93103821 CTTGACTGTTGGATGGAAACAGG + Intronic
1121588767 14:95083160-95083182 GTGGGCTGTGTGGGGGGAACCGG - Intergenic
1122075300 14:99231597-99231619 CTGGACTGTGTGAGGGGCACGGG + Intronic
1122232351 14:100313069-100313091 CTGGATGGGTTGGGGGAAATCGG + Intergenic
1124155220 15:27219458-27219480 CTGGACTGTGGGGTGGAAAGAGG - Intronic
1126777671 15:52113098-52113120 TTGGATTGTTTAGTGGAAACGGG + Intergenic
1129292428 15:74578536-74578558 GTGGAGTGTCTGGGGGACACAGG + Intronic
1132545045 16:529032-529054 CTGGCCTGTCTGGGGGAGGCAGG + Intronic
1133083013 16:3338441-3338463 CTGGGCAGATTGGGGGAAAGGGG + Intergenic
1144119257 17:12134417-12134439 CTGAACTGAATGGGGGAAAATGG + Intronic
1146307477 17:31741700-31741722 CTGGAATATTTGGGGATAACTGG - Intergenic
1147455974 17:40538396-40538418 CTGAAATGTTTGGGGGAAGAAGG + Intergenic
1149501356 17:57155044-57155066 GTGGACTGATTGGGGCCAACTGG + Intergenic
1150288289 17:63966337-63966359 CTTTTCTGTTTGGGGGACACAGG - Intronic
1150914749 17:69425217-69425239 CTGGACAGAGTGGAGGAAACTGG + Intronic
1151957625 17:77388261-77388283 CTGGGCTGTTTGGGGCAGCCAGG + Intronic
1154176661 18:12090502-12090524 CTGGTCTGTGTGGTGGAAACGGG + Intergenic
1156685431 18:39639667-39639689 ATAAACTGTTTGGGGGAAAAGGG - Intergenic
1157134543 18:45040899-45040921 CTGGACTTTTGGGGGGAAATAGG + Intronic
1157407652 18:47436741-47436763 GTGAACTCTTTGGGGGCAACAGG - Intergenic
1159096495 18:63908127-63908149 CTGGACTTTTTTGGGGGAAGGGG - Intronic
1160244612 18:77146984-77147006 CTGTGCTGTTTGGAGAAAACTGG + Intergenic
1161171741 19:2815570-2815592 CTGGAGTGTTTGGGGAAACCCGG - Exonic
1163189138 19:15663451-15663473 CTGGACGGTTTGGGGACAACTGG + Intergenic
1163214106 19:15863393-15863415 CTGGACTGTTTAGGGAATGCAGG + Intergenic
1165992564 19:39825073-39825095 CTGGCCTGTCTCTGGGAAACAGG - Intergenic
1166269679 19:41706345-41706367 CTGGACGGTGAAGGGGAAACAGG - Intronic
925380213 2:3419498-3419520 CTGGACAGTTTAGGGGAACGTGG + Intronic
926088696 2:10036245-10036267 CTGGCCTGTCTGGGGGAGGCTGG + Intergenic
926659705 2:15450993-15451015 TGGGACTGTTTGGGAGAAAAAGG + Intronic
928791399 2:34959810-34959832 CTGGATTATTTGTGGGAAAAGGG - Intergenic
928829468 2:35462400-35462422 CTGGACTGGCTGGGGGAGATTGG - Intergenic
929642214 2:43593581-43593603 CTAGACTGTTTTGGAGAAAAAGG + Intronic
931961277 2:67486254-67486276 CTGGAAAGTTGGGGGGAAATGGG - Intergenic
933614278 2:84468399-84468421 CTGGACTCCTTGGGGTAAACAGG - Intergenic
933782774 2:85813544-85813566 TTGGGCTGTTTGGGGGAAGTGGG - Intergenic
934177852 2:89592975-89592997 ATGGACTGTTTGGAGGGCACTGG - Intergenic
934288150 2:91667276-91667298 ATGGACTGTTTGGAGGGCACTGG - Intergenic
936134644 2:109879484-109879506 CTTGACAGTTTTGGGGATACTGG + Intergenic
936210053 2:110492001-110492023 CTTGACAGTTTTGGGGATACTGG - Intergenic
936429246 2:112447473-112447495 CTTGACAGTTTTGGGGATACTGG - Intergenic
943980194 2:194539698-194539720 CTCTGCTGTTTGGGGGAAGCAGG - Intergenic
948278734 2:236730147-236730169 GTGGACTCTGTGGGGAAAACAGG - Intergenic
948321964 2:237076937-237076959 CTGGGATGTTTGGGGGAAATAGG - Intergenic
948528115 2:238586002-238586024 TTGGTCTATTTGGGGGAAAGCGG + Intergenic
1169590201 20:7132288-7132310 CTGAAATGTTTGGGGGGCACAGG - Intergenic
1170154618 20:13258113-13258135 ACGGAATGTTTGGGGGACACAGG - Intronic
1174428137 20:50447982-50448004 CTGGACTGTGTGTGCGAAGCGGG + Intergenic
1175290450 20:57871711-57871733 CTGGAATATTTGTGGGAAAAAGG - Intergenic
1175406592 20:58736523-58736545 CAGTGCTTTTTGGGGGAAACAGG - Intergenic
1175712653 20:61233185-61233207 CTGGACTGTTGGGGTGAGCCTGG - Intergenic
1175789612 20:61733033-61733055 CTGGGCTGTGTGGGGGCAGCAGG + Intronic
1177837767 21:26204622-26204644 GCGGACTGTTGGAGGGAAACAGG - Intergenic
1179427091 21:41290279-41290301 CTGGAAGGTTGGGTGGAAACTGG - Intergenic
1179522059 21:41952193-41952215 CTGTACTTTTTGGAGGAAAAAGG - Intronic
1183359991 22:37378525-37378547 CTGGACTGTTTGGGAAGAGCTGG - Intronic
1184769575 22:46589452-46589474 CTGGGCTGTTTGGGGGGATGGGG + Intronic
1185097339 22:48818174-48818196 CGGAACTGTTTTGGGCAAACAGG - Intronic
949220156 3:1623188-1623210 CTGGACTGCTTTAGGAAAACAGG + Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
950889447 3:16390051-16390073 CTGGGCTGTTTGGTGGTAGCTGG - Intronic
951089586 3:18556634-18556656 CTGCACTGTGTGGTAGAAACAGG - Intergenic
951109654 3:18786793-18786815 CTGGAGTCTTTGGGGTAAAGGGG - Intergenic
951329130 3:21344165-21344187 CTGGACTTTTTGGCGAACACTGG + Intergenic
952323601 3:32300477-32300499 CTTGCCTTTTTGGGGGAAAGGGG + Intronic
952485626 3:33807084-33807106 CTGAGCTGTATGGGGGGAACAGG - Intronic
954758885 3:52860028-52860050 CTGGACTGTTCTAGGGAAAGGGG - Intronic
956561537 3:70582060-70582082 CTGGAAGTTTTGAGGGAAACTGG - Intergenic
957172264 3:76752691-76752713 CTGAAGTGTTTGAGGAAAACTGG + Intronic
957645887 3:82925782-82925804 CAGGTGTGTTTGGGGGAAACTGG + Intergenic
959085129 3:101844332-101844354 CAGGACTTTTTAGGTGAAACTGG + Intronic
961351109 3:126304362-126304384 CTAGACTGGCTGGTGGAAACAGG + Intergenic
961924324 3:130461108-130461130 GTGGACTTTTTGGGGAAATCAGG + Intronic
962141943 3:132799649-132799671 CTGGACTGTTCTGGGAAAACAGG - Intergenic
962302281 3:134252977-134252999 TTGAACTGTTTGGAGGTAACTGG - Intergenic
963263321 3:143214534-143214556 CAGGACAGTCTGGGGCAAACTGG - Intergenic
964430775 3:156604077-156604099 TTGGACTGTTTGGTCCAAACTGG - Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
969042385 4:4309412-4309434 ATGGACTGTTTGGAGGGCACTGG + Intronic
969091826 4:4699949-4699971 CTGGAGTGATTGGGGAACACAGG + Intergenic
972577305 4:40363770-40363792 CTGGACTGTCTTGGACAAACTGG + Intergenic
973532931 4:51851202-51851224 CAGGACTGTGTGGGGGAGACCGG + Intronic
974131391 4:57760721-57760743 CAGGAATGTGTGGTGGAAACAGG - Intergenic
978360960 4:107931165-107931187 CTGTACTGAGTGTGGGAAACTGG - Intergenic
983406266 4:167335122-167335144 CAGGATAGTTTGGGGGAAAGGGG - Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
992566136 5:77997053-77997075 CTGGAGTGGCGGGGGGAAACGGG + Intergenic
993023871 5:82624405-82624427 CAGGACTGTTGTGAGGAAACTGG + Intergenic
993308315 5:86296749-86296771 ATGGACTGTTTGAAGGAGACAGG - Intergenic
996273193 5:121633648-121633670 CTGGAATATTTGGAGGAAGCAGG - Intergenic
997262937 5:132477812-132477834 CAGGCCTGTTTGGAGCAAACGGG - Intergenic
997579269 5:135007022-135007044 TTGGACAGTTTGGGGTAACCTGG - Intronic
999615706 5:153420882-153420904 CTGGATTGTTTGAGGGAGGCAGG - Intergenic
1003543874 6:7042040-7042062 CTTGACTGGTTGTGGGAGACAGG - Intergenic
1005804812 6:29464358-29464380 CTGGACTCTTTAGTGGAAAATGG - Intergenic
1007676367 6:43598903-43598925 CTGAACTGTTTGTTGGAAAAAGG + Intronic
1011725567 6:90206971-90206993 TTGGACTGTTTGGGGGGAATTGG - Intronic
1015525487 6:134171874-134171896 CTGGACTTTTTGAGGGTGACTGG + Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018194553 6:161343720-161343742 CTGGACAGTTAGGGGCAAAGGGG - Intergenic
1018290782 6:162290748-162290770 CTGGACTGTTAGGGCAGAACTGG - Intronic
1019851492 7:3562598-3562620 CTGGAGAGTCTGGAGGAAACTGG + Intronic
1022416226 7:30179401-30179423 CTGGACTATGAGAGGGAAACAGG - Intergenic
1022576174 7:31499139-31499161 ATAGAAGGTTTGGGGGAAACTGG + Intergenic
1023896468 7:44437571-44437593 CTGGCCTGTGTGGGGGCCACAGG + Intronic
1024750528 7:52459932-52459954 CTGGACTTTTTGGGGGTAAGTGG - Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1027553356 7:79630065-79630087 TTGAACATTTTGGGGGAAACAGG - Intergenic
1029585072 7:101465401-101465423 CTGGAGTGTGAGAGGGAAACAGG - Intronic
1031109612 7:117592236-117592258 CTGGAGAGTTTGGGGAAAAAAGG + Exonic
1031144166 7:117979356-117979378 GTGGCCTGTATGGTGGAAACTGG - Intergenic
1031742892 7:125456450-125456472 CTGGACTTATTGGGAAAAACAGG - Intergenic
1032081976 7:128863786-128863808 CTGGACTGTTTGGGGGAAACAGG - Intronic
1035750635 8:1993589-1993611 CTGGACTGTGTAAGGGCAACTGG - Intronic
1038521183 8:28233456-28233478 CTGGGGAGTTTGGGGGAAAGTGG + Intergenic
1039057904 8:33551171-33551193 CTGGACTGCCTGGGGCAAGCCGG + Intronic
1040750912 8:50705987-50706009 CTGGAATGTTTGCGTAAAACAGG + Intronic
1041800472 8:61792460-61792482 CTGGAGTGTTTCAGGGAAAAAGG + Intergenic
1043121172 8:76326558-76326580 CTGAACTGTTTGGAGGTAAAAGG - Intergenic
1046474908 8:114729547-114729569 CTGGACTTTTTTAGGGAAAAGGG - Intergenic
1047794085 8:128236210-128236232 CTGGCTGGTTTGGGGGAAATGGG - Intergenic
1050005614 9:1126822-1126844 GTTGACAGTTTGGGGGAAATAGG + Intergenic
1051095595 9:13462025-13462047 CAGGAAAGTTTGAGGGAAACAGG + Intergenic
1051135766 9:13918723-13918745 CTGGAATGTTTGGGAGAATCAGG - Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1053130183 9:35610125-35610147 CTGGACTGTTCCTGGGAAAAGGG - Exonic
1053145770 9:35711206-35711228 CTGGACTGTGTGAGAGAGACTGG - Intronic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1057441643 9:95087917-95087939 CTGGCCTGTTTGGGGTGAAGTGG + Intergenic
1060343001 9:122793210-122793232 CTGGACTGTTCTGGGAAAACTGG - Intergenic
1061416048 9:130447461-130447483 CTGGCCTGTTTGCTGGAAGCTGG + Intronic
1061475131 9:130860217-130860239 CTTGACTGTTAGTGGGACACGGG + Intronic
1062026425 9:134342723-134342745 CTGGTGGGTTTGGGGGAACCTGG + Intronic
1197270319 X:124418040-124418062 ATGGACTGTGTAGTGGAAACAGG - Intronic
1197989507 X:132302686-132302708 CAGGAGAATTTGGGGGAAACTGG - Intergenic
1198672523 X:139096279-139096301 CTATTCTGTCTGGGGGAAACTGG + Intronic
1199084445 X:143612455-143612477 CTGGGATATTTAGGGGAAACTGG - Intergenic
1200249524 X:154545448-154545470 ATGGACTTCTTGGGGAAAACAGG - Intronic