ID: 1032082771

View in Genome Browser
Species Human (GRCh38)
Location 7:128868394-128868416
Sequence CACCCTAGCCTGCTTGTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 142}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032082771_1032082773 -6 Left 1032082771 7:128868394-128868416 CCTGTGACAAGCAGGCTAGGGTG 0: 1
1: 0
2: 0
3: 17
4: 142
Right 1032082773 7:128868411-128868433 AGGGTGGCCCCCCTCCCTGCAGG 0: 1
1: 0
2: 3
3: 26
4: 294
1032082771_1032082774 0 Left 1032082771 7:128868394-128868416 CCTGTGACAAGCAGGCTAGGGTG 0: 1
1: 0
2: 0
3: 17
4: 142
Right 1032082774 7:128868417-128868439 GCCCCCCTCCCTGCAGGTAGAGG No data
1032082771_1032082782 14 Left 1032082771 7:128868394-128868416 CCTGTGACAAGCAGGCTAGGGTG 0: 1
1: 0
2: 0
3: 17
4: 142
Right 1032082782 7:128868431-128868453 AGGTAGAGGATCCTGAAGCTAGG No data
1032082771_1032082783 15 Left 1032082771 7:128868394-128868416 CCTGTGACAAGCAGGCTAGGGTG 0: 1
1: 0
2: 0
3: 17
4: 142
Right 1032082783 7:128868432-128868454 GGTAGAGGATCCTGAAGCTAGGG 0: 1
1: 0
2: 0
3: 8
4: 131
1032082771_1032082784 24 Left 1032082771 7:128868394-128868416 CCTGTGACAAGCAGGCTAGGGTG 0: 1
1: 0
2: 0
3: 17
4: 142
Right 1032082784 7:128868441-128868463 TCCTGAAGCTAGGGTAATGATGG 0: 1
1: 0
2: 1
3: 9
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032082771 Original CRISPR CACCCTAGCCTGCTTGTCAC AGG (reversed) Intronic
904465487 1:30704931-30704953 CACCCAAGCCTGCTGCTCCCAGG + Intergenic
904587421 1:31587988-31588010 CCCCCTTGCCTGCTGGGCACTGG - Intergenic
907176767 1:52531257-52531279 CACCCCAGCCTGGGTGACACAGG - Intronic
908269011 1:62404866-62404888 CACCCTGGGCTGCCTCTCACAGG + Intergenic
909835533 1:80249829-80249851 TCCCCTAGCCTGCTCTTCACTGG - Intergenic
916125334 1:161565430-161565452 CAAACTTGCCTCCTTGTCACTGG - Intergenic
916135220 1:161646820-161646842 CAAACTTGCCTCCTTGTCACTGG - Intronic
917725886 1:177826668-177826690 CACACCCACCTGCTTGTCACTGG + Intergenic
920209197 1:204315761-204315783 CATCCCAGGCTGCCTGTCACGGG - Intronic
920434808 1:205940883-205940905 CACCCTGGCATCCTTATCACTGG + Intronic
922565207 1:226597127-226597149 CTCCCTGGGCTGCTTGGCACTGG + Intronic
922874052 1:228926094-228926116 CACCCTAGACTTTATGTCACAGG + Intergenic
1068587612 10:58816824-58816846 CACCAGCGCTTGCTTGTCACTGG + Intronic
1070194219 10:74141390-74141412 CACCCTAGCCTGGGTGACAGAGG + Intronic
1071127668 10:82354066-82354088 CACCCCAGCCTGTTTGAGACAGG - Intronic
1074674383 10:115831511-115831533 CACCCCGGCGTGCTTTTCACTGG - Intronic
1074905778 10:117862218-117862240 CACCCTAGCCTGCTTGAAGTGGG + Intergenic
1075719661 10:124577291-124577313 CACCCCAGCCTCCTGGGCACAGG + Intronic
1076293111 10:129362727-129362749 CACCCTAGGCTGTTTCTCCCGGG - Intergenic
1076645159 10:131948702-131948724 CACCATAACCTGCTGTTCACAGG - Intronic
1077112377 11:867570-867592 CACTCTAGCCTGGATGACACAGG + Intergenic
1077177793 11:1198499-1198521 CACCCTGGCCTGCCTGGCTCCGG + Intronic
1077252604 11:1567230-1567252 CACCGTAGCCCGCTTTGCACAGG - Intronic
1077376694 11:2208615-2208637 CCCCCTGGCCTGCTGGGCACAGG + Intergenic
1085449554 11:76623705-76623727 CAGCCCTGCCTGCTTGTCTCTGG - Intergenic
1085582522 11:77667256-77667278 GACCCTAGGCTGGCTGTCACGGG + Exonic
1087509191 11:99068546-99068568 TAACCCAGCCTGCTTCTCACGGG - Intronic
1088368899 11:109067303-109067325 CACCCCAGCCTGCTTGTGGGAGG + Intergenic
1088677752 11:112212697-112212719 CACCCAAGCCTGCTTGTCCAGGG + Intronic
1089706126 11:120279191-120279213 CACCACTGCCTGCTTGTCTCGGG + Intronic
1090647551 11:128777860-128777882 CAACCTAACCTGCTTTTCATCGG - Intronic
1093832817 12:23785046-23785068 CACTCTAGCCTGGGTGACACAGG + Intronic
1096065435 12:48735848-48735870 CACTCCAGCCTGGTTGTCAAAGG + Intergenic
1097195975 12:57242687-57242709 CACCCCAGCCTGCCTCTCACTGG + Intergenic
1104022791 12:125004877-125004899 CACTCCAGCCTGCGTGACACAGG - Intronic
1104586507 12:130052351-130052373 CCCCCTAGCCTGCCTGTAATAGG + Intergenic
1105996335 13:25675776-25675798 CATCCAAGCCTGCCTGTCAAAGG - Intronic
1109065654 13:57686053-57686075 CACTCTAGCCTGGGTGACACAGG + Intronic
1110789315 13:79569760-79569782 CACACTTGCCAGGTTGTCACAGG + Intergenic
1114684345 14:24513948-24513970 CACCCTACTCTTCTTGTCCCTGG + Intergenic
1114881352 14:26789928-26789950 CTCCCTAGCCTAGTTGTTACTGG + Intergenic
1118824766 14:69370043-69370065 CTCCCTAGACTGCTTCTGACTGG - Intergenic
1119474702 14:74920350-74920372 CACCCTAGCCTTCTTTACACTGG - Intronic
1121006009 14:90491118-90491140 CACCCTCACCTGCATTTCACTGG + Intergenic
1121412836 14:93759851-93759873 CACCCTGCCCTGCTTGGCAGAGG + Intronic
1122554012 14:102566934-102566956 CACCCTAGCCTGGGTGACAGAGG - Intergenic
1122743187 14:103883404-103883426 CACCCTGGCCTGCAGGGCACAGG + Intergenic
1122856130 14:104561061-104561083 CACCCCAGCCTGCTGGCCTCTGG - Intronic
1124476650 15:30040519-30040541 CACTCTAGCCTGGGTGTCGCAGG + Intergenic
1131761165 15:95624116-95624138 CAGCCTAGCCTGGTGGTCTCAGG - Intergenic
1132359402 15:101200369-101200391 GAGCCTGGCCTGCTTCTCACAGG + Intronic
1134164166 16:11916358-11916380 CACTCTGGCCTGCTGGACACAGG + Intergenic
1135017661 16:18937272-18937294 CACCCTAGCCTGGGTGACAGAGG - Intergenic
1135778378 16:25277033-25277055 CACTCTAGCCTGGGTGTCAGAGG - Intergenic
1138602749 16:58066427-58066449 CACCCTAGCCTGGGTTACACAGG - Intergenic
1139052721 16:63145621-63145643 CATCATATCCTGCTTGACACAGG + Intergenic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1142717463 17:1754915-1754937 CACCCTAGCCTAGGTGTCCCGGG - Exonic
1143376253 17:6469354-6469376 CACCCTGGCCTGGGTGCCACCGG + Intronic
1144114789 17:12077480-12077502 AACCCTAGCCTGCTTATCTCCGG - Intronic
1148324669 17:46776340-46776362 CACTCTAACCTGCTTCTAACAGG - Intronic
1152941810 17:83176757-83176779 CACACCAGCCTGCTTGTGCCAGG - Intergenic
1155293373 18:24363673-24363695 CACTCTAGCCTGGGTGACACAGG - Intronic
1155377380 18:25175184-25175206 CACAATAGCCTGTGTGTCACAGG + Intronic
1160376548 18:78418126-78418148 CACTCCAGCCTGGGTGTCACAGG - Intergenic
1160733849 19:652990-653012 CACCCTGGCCTGCGTGTGCCTGG - Intronic
1160790923 19:923394-923416 CCCCCAACCCTGCTGGTCACTGG - Intergenic
1160848754 19:1179403-1179425 CACTCCAGCCTTCTTGTCAACGG - Intronic
1165855593 19:38877977-38877999 CACCCTGGCCTTCTGGTCAATGG - Intronic
1166234030 19:41442899-41442921 CACCCTTCCCTGCCTGTCTCAGG - Intergenic
1167877623 19:52427460-52427482 CACTCCAGCCTGGATGTCACAGG + Intergenic
1168601194 19:57720033-57720055 TACCCCAGCATGCTTGTGACGGG - Exonic
925059720 2:881532-881554 TACCCTAGCCTGGGTGTGACAGG + Intergenic
925414396 2:3659199-3659221 CAGCCTTCCCTGCTTGTCAGAGG + Intronic
925872606 2:8284169-8284191 CACCCCGGCCTGCATGTCTCAGG + Intergenic
927469416 2:23361573-23361595 CACCCTGGCCTGCATGTGAGTGG - Intergenic
927529358 2:23780132-23780154 CACCCTAGCCTCCTGGTAGCTGG - Intronic
927706116 2:25297441-25297463 CACCCCAGCCTGGTGGACACTGG + Intronic
928574065 2:32637122-32637144 CAACCTAGCTTGAGTGTCACAGG + Intronic
928746044 2:34417041-34417063 CACACTAGCTTGCTTCTCCCAGG - Intergenic
929260640 2:39863394-39863416 CACCTTAGCCTGGATTTCACTGG - Intergenic
929433989 2:41913235-41913257 CACCCCAGCTTGATTGTCATAGG + Intergenic
930053690 2:47236193-47236215 TACCCTATCCTGCTGTTCACAGG - Intergenic
934720879 2:96575660-96575682 CAGACCAGCCTGTTTGTCACAGG - Intergenic
936118383 2:109720852-109720874 CTCCCTCTCCTGATTGTCACTGG + Intergenic
940472372 2:154115452-154115474 CACTCTAGCCTGGGTGTCAGAGG - Intronic
942918480 2:181342278-181342300 CAGCCTAGCCTGCTGGCCCCAGG + Intergenic
943799045 2:192034848-192034870 TGCCCTATCCTGCTTTTCACTGG + Intronic
944149647 2:196544314-196544336 CACTCTAGCCTGCCTTTCAGGGG - Intronic
944408657 2:199414689-199414711 CAGCCTTTCCTGCTTGTCACGGG + Intronic
944936624 2:204576233-204576255 CACCCCAGCCTGCTGGCCAGAGG - Intronic
947983224 2:234427336-234427358 CCCCAGAGCCTGCTTGTCAAAGG - Intergenic
1172173697 20:32959969-32959991 CAGCCTCACCTGCTTGTCCCTGG - Intronic
1172807513 20:37623000-37623022 CAGCCTAGCCTGCTGGTCCTGGG + Intergenic
1174543399 20:51307007-51307029 CACCCCTGCCTGCTTGAGACCGG - Intergenic
1175040413 20:56044451-56044473 CACCCTATCCTCCTGGTTACTGG - Intergenic
1177022391 21:15878523-15878545 AACCCTTGCCTTCCTGTCACAGG + Exonic
1178589759 21:33899303-33899325 CACTGTGGCCCGCTTGTCACTGG - Exonic
1181767170 22:25100227-25100249 CACCCAGACCTGCTGGTCACTGG + Intronic
1182626158 22:31648104-31648126 CACCCAAACTTGCTGGTCACTGG - Intronic
1183295161 22:37024980-37025002 TACCCTTGCCTTCTTTTCACAGG + Intronic
1185316950 22:50183394-50183416 CTCCCAAGCCTGCTTTTCTCTGG - Intergenic
1185339522 22:50285222-50285244 CACCTGAGCCTGCCTGTCACCGG + Intronic
1185339548 22:50285305-50285327 CACCTGAGCCTGCCTGTCACCGG + Intronic
1185339561 22:50285346-50285368 CACCTGAGCCTGCCTGTCACCGG + Intronic
1185339574 22:50285387-50285409 CACCTGAGCCTGCCTGTCACCGG + Intronic
1185339601 22:50285471-50285493 TACCTGAGCCTGCCTGTCACCGG + Intronic
1185339614 22:50285512-50285534 CACCTGAGCCTGCCTGTCACCGG + Intronic
1185339638 22:50285593-50285615 CACCTGAGCCTGCCTGTCACCGG + Intronic
1185339662 22:50285674-50285696 CACCTGAGCCTGCCTGTCACCGG + Intronic
1185339675 22:50285715-50285737 TACCTGAGCCTGCCTGTCACCGG + Intronic
949742290 3:7250555-7250577 CACTCCAGCCTGGTTGGCACAGG - Intronic
949898488 3:8790577-8790599 CACACTAGCCTGCTGGTCCAAGG - Intronic
956089896 3:65655121-65655143 CACTCTACCCTGCTTTACACTGG - Intronic
956588110 3:70885217-70885239 CACCCTCACCTGCCTGTCACTGG - Intergenic
959581895 3:107991149-107991171 CAGCAGAGCCTGCTTGTCACAGG + Intergenic
961223685 3:125219967-125219989 CACTCTAGACAGCCTGTCACTGG - Intergenic
962518451 3:136175652-136175674 CACCCTAGCCTGCGTGACAGAGG + Intronic
964304567 3:155326427-155326449 AACCCTTGCCTGCTAGCCACTGG - Intergenic
965321003 3:167251082-167251104 CACCCCATCCTGCTGGTCAGTGG - Intronic
966869089 3:184278378-184278400 CAGCCCAGCCTGCCTGTCACAGG - Intronic
967704759 3:192637004-192637026 CACCTTAGCCTGATTATCATAGG + Intronic
973936576 4:55852711-55852733 GACCCTTTCCTGCTTGGCACCGG - Intergenic
978242207 4:106529322-106529344 CACTCCAGCCTGAGTGTCACAGG + Intergenic
978410085 4:108416617-108416639 CAGCCTTGGCTGCTTGTCATGGG - Intergenic
980990436 4:139734844-139734866 CACCCCAGCCTGCTCGCCGCCGG - Intronic
985888986 5:2701112-2701134 CACCCTGCCCTGCTCGCCACTGG + Intergenic
986150833 5:5129258-5129280 CACCCTAGCTTCCTTGTCCCAGG - Intergenic
986234578 5:5895150-5895172 CACCCTACCCAGCCTGTCATGGG + Intergenic
990851399 5:60208949-60208971 CACCTTTTCATGCTTGTCACTGG - Intronic
991570548 5:68048985-68049007 CACACAAGCCTGCTTGTGCCTGG - Intergenic
992904776 5:81335396-81335418 CACTCTAGCCTGGGTGACACAGG - Intronic
995006629 5:107204525-107204547 CACACCAGCATGCTTCTCACTGG + Intergenic
998570258 5:143250755-143250777 CACCCTTTCCTTCTTGTCCCAGG + Intergenic
1001405488 5:171474090-171474112 AACCCTAGACTGTATGTCACAGG + Intergenic
1008659147 6:53647605-53647627 GACCACAGCCAGCTTGTCACAGG - Intergenic
1012915053 6:105160960-105160982 CTCCCCAGCCTGCTTCTCATGGG + Intronic
1016821751 6:148353100-148353122 CACTCCAGCCTGCGTGACACAGG - Intronic
1019140688 6:169940503-169940525 CATCACAGCCTGGTTGTCACCGG - Intergenic
1019917021 7:4140174-4140196 CACCCCAGCCTGCACCTCACAGG + Intronic
1031377717 7:121048571-121048593 CACCCCAGCCTGGGTGTCAGAGG - Intronic
1032082771 7:128868394-128868416 CACCCTAGCCTGCTTGTCACAGG - Intronic
1033807869 7:144975311-144975333 CACCCCATCCTGCTTCTCATGGG - Intergenic
1034884132 7:154784672-154784694 CACCCCTGCCTGATTGTGACGGG - Intronic
1038731400 8:30131123-30131145 CACCCCAGCCTGGTTGACAGAGG - Intronic
1039465573 8:37783067-37783089 CACTCTAGCCTGCGTGACAGAGG + Intergenic
1042537906 8:69877551-69877573 CACTCCAGCCTGCGTGACACAGG + Intergenic
1051644362 9:19252767-19252789 CACCCTAGCCTGAGTGACAGAGG - Intronic
1052989887 9:34512914-34512936 CCCTCTGGCCTGCTTGTCCCAGG - Intronic
1058957648 9:109963871-109963893 CACCCTAGCCTGCACCTCAAAGG - Intronic
1061290736 9:129649174-129649196 CACCCTTACCTGGCTGTCACAGG - Intergenic
1061357106 9:130114414-130114436 CACTCCAGCCTGCGTGACACAGG - Intronic
1062138537 9:134942845-134942867 CACCCTGCTCTGCTTGGCACAGG + Intergenic
1189774364 X:44456916-44456938 CAGCCCAGCCTTCTTGTCTCTGG - Intergenic
1190100487 X:47518989-47519011 CACCCTAGCCTGGGTGACAGAGG + Intergenic
1195084086 X:101397912-101397934 AACCCTAGCTTCCTTTTCACAGG + Exonic
1198880501 X:141275984-141276006 AAGAATAGCCTGCTTGTCACTGG + Intergenic
1200101197 X:153689721-153689743 CACCCCAGCCTGCTGGCCTCAGG + Intronic
1201788496 Y:17810782-17810804 CACACTGGCCTTCTTGTCTCAGG + Intergenic
1201813057 Y:18095206-18095228 CACACTGGCCTTCTTGTCTCAGG - Intergenic