ID: 1032083281

View in Genome Browser
Species Human (GRCh38)
Location 7:128870462-128870484
Sequence AAGAGAGCCGAGGCCTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032083281_1032083288 10 Left 1032083281 7:128870462-128870484 CCCCAGGAGGCCTCGGCTCTCTT 0: 1
1: 0
2: 1
3: 21
4: 164
Right 1032083288 7:128870495-128870517 GTCTCCGCTTTCTGATCCTGAGG 0: 1
1: 0
2: 3
3: 19
4: 146
1032083281_1032083292 30 Left 1032083281 7:128870462-128870484 CCCCAGGAGGCCTCGGCTCTCTT 0: 1
1: 0
2: 1
3: 21
4: 164
Right 1032083292 7:128870515-128870537 AGGGTCCTCCTCTCAGACTCAGG 0: 1
1: 0
2: 0
3: 17
4: 269
1032083281_1032083289 11 Left 1032083281 7:128870462-128870484 CCCCAGGAGGCCTCGGCTCTCTT 0: 1
1: 0
2: 1
3: 21
4: 164
Right 1032083289 7:128870496-128870518 TCTCCGCTTTCTGATCCTGAGGG 0: 1
1: 0
2: 0
3: 15
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032083281 Original CRISPR AAGAGAGCCGAGGCCTCCTG GGG (reversed) Intronic
900367901 1:2318775-2318797 CAGAGAGCCGTGGCTTCCTAGGG - Intergenic
900458189 1:2787406-2787428 AAGAGGGCACAGGCCTCCCGTGG - Intronic
901474383 1:9479550-9479572 AAGGGAGCAGGGGCCTCCAGAGG - Intergenic
904083412 1:27886353-27886375 AAGACAGTCCAGGCCTCCCGGGG - Exonic
904395755 1:30220431-30220453 AAGAGAGCAGAGGAATTCTGGGG + Intergenic
904923522 1:34027930-34027952 AAGTGGGGCGAGGGCTCCTGGGG + Intronic
910169839 1:84366265-84366287 CAGAGAGAGGAGGGCTCCTGAGG - Intronic
910703869 1:90105587-90105609 AAAAGAGCTGAGGCTTCTTGTGG + Intergenic
913366168 1:118041685-118041707 AAGAAACCCTAGGCCTACTGTGG + Intronic
916428797 1:164707931-164707953 GAGAGAGCTGAGGCACCCTGAGG + Intronic
916735169 1:167601310-167601332 ATGAGACCCAAGGTCTCCTGAGG + Intergenic
917329990 1:173870777-173870799 CAGAGAGCTAAGTCCTCCTGAGG + Exonic
917806598 1:178619152-178619174 AAGATATCAGAGGCCTTCTGGGG + Intergenic
919980652 1:202641160-202641182 AGTAGAGCCAAGGTCTCCTGGGG + Intronic
920965477 1:210697449-210697471 AAGATAGACGAAGACTCCTGAGG - Intronic
922782385 1:228263696-228263718 GAGAGGGCCTGGGCCTCCTGTGG - Intronic
922985363 1:229862169-229862191 GAGAAAGCTGAGGCCTGCTGAGG + Intergenic
923219728 1:231882069-231882091 AGAAGAGCCAAGTCCTCCTGTGG - Intronic
923712402 1:236397685-236397707 AAGAGAAAGGAGGCCTCCTAAGG + Intronic
924709934 1:246523365-246523387 AAGGGAGGCGAGGCCTCTGGAGG + Intergenic
1063222239 10:3979863-3979885 AAGAGAGCCAAGGCCAGGTGGGG + Intergenic
1067210827 10:44259404-44259426 CAGAGAGCACAGGGCTCCTGGGG + Intergenic
1070341525 10:75502684-75502706 AAGGGTTCAGAGGCCTCCTGAGG + Intronic
1070836639 10:79451498-79451520 GAGAGACCCCAGGCCTCCAGGGG + Intergenic
1072880128 10:99218429-99218451 AAGAGAGTCGAGGACACATGTGG - Intronic
1075619826 10:123918011-123918033 GAGAGAGTCCATGCCTCCTGAGG + Intronic
1075642280 10:124073433-124073455 AACAGAGCCCAGGGGTCCTGGGG + Intronic
1076403678 10:130198711-130198733 AAGAGATCCAAGAGCTCCTGAGG - Intergenic
1076531764 10:131149675-131149697 CAAAGAGCCCAGGCCTCGTGGGG - Intronic
1078011122 11:7573963-7573985 AAAGGAGCTGAGGCCCCCTGAGG - Intronic
1078471368 11:11589653-11589675 ATGACAGCCCAGCCCTCCTGGGG + Intronic
1080048451 11:27834436-27834458 CAGACAGCCCAGGCCTCCTTTGG + Intergenic
1083160029 11:60849034-60849056 AAGTGAGCCTTGGCCTCCTGTGG - Intronic
1083460391 11:62807200-62807222 AAGGGAGCAGAGGCCAGCTGGGG - Exonic
1084647602 11:70467708-70467730 CAGAGAGCCCAGGGCTCCTGTGG + Intergenic
1084679459 11:70657980-70658002 AAGAGAAACGTGGCCTGCTGAGG - Intronic
1084971190 11:72772988-72773010 AAGAGACTCAAGGCCTCATGGGG - Intronic
1085397140 11:76212229-76212251 CAGAGAGCAAAGGCCTCCGGGGG + Intergenic
1085587723 11:77726890-77726912 AAGAAAGCTGAGGCCTAATGAGG - Intronic
1089461430 11:118656473-118656495 TAGAGAGCCCAGGACTGCTGTGG + Intronic
1090714755 11:129420413-129420435 AACAGAGCTCAGGCCTCCAGAGG - Intronic
1091387904 12:106414-106436 AAGAGAGGCCAGGCCTTTTGAGG - Intronic
1102254484 12:111407596-111407618 ATGAGAGCCAGGGCCTACTGGGG + Intronic
1104763837 12:131313871-131313893 AAGAGAGAAAGGGCCTCCTGGGG - Intergenic
1104815660 12:131644185-131644207 AAGAGAGGAAGGGCCTCCTGGGG + Intergenic
1104912518 12:132246021-132246043 AAGAAAGCCGAGGCCCTCAGAGG - Intronic
1104932313 12:132346151-132346173 AAGAGAGCAGAGGTCGCCTGGGG + Intergenic
1105409716 13:20161348-20161370 AGGAGAGCCGAGGGCTGTTGGGG + Intergenic
1109582577 13:64362219-64362241 AAGAGAGCAAAGACCACCTGGGG + Intergenic
1110799867 13:79682430-79682452 AAGAAAACCCAGGCCTCATGGGG - Intergenic
1112092870 13:96100734-96100756 AAGAGAGCTGATGCATTCTGTGG + Intronic
1113863842 13:113508673-113508695 AAGTGAGCCCGGGCCTCATGGGG + Intronic
1115041315 14:28932513-28932535 AAGATAGCCAAGGCCACCAGTGG - Intergenic
1122415837 14:101549087-101549109 CCGAGAACCGAGGCCTCCTGGGG - Intergenic
1122597606 14:102904017-102904039 AAGAGAGCAGAGGCCACCTGTGG + Intronic
1122774524 14:104111409-104111431 AAGAGCGTCCAGGCCACCTGGGG + Intronic
1123048139 14:105528245-105528267 GGGAGGGCCGAGGCCTCCTTGGG + Intronic
1123942650 15:25224080-25224102 AAGACTGCCCAGGCCACCTGAGG + Intergenic
1124496348 15:30189912-30189934 AGTAGAGCCAAGGTCTCCTGGGG + Intergenic
1124747226 15:32348736-32348758 AGTAGAGCCAAGGTCTCCTGGGG - Intergenic
1127417568 15:58771878-58771900 CAGCGACCCGAGCCCTCCTGGGG + Exonic
1128680247 15:69646321-69646343 AAAAGAGCAGATGACTCCTGTGG - Intergenic
1128748904 15:70134533-70134555 AAGGGAGATGAGGCCACCTGGGG - Intergenic
1132552001 16:557354-557376 TACAGAGCATAGGCCTCCTGGGG - Intergenic
1132652781 16:1029071-1029093 AAGGGGGCCAAGGCCTCCAGAGG - Intergenic
1133090039 16:3397063-3397085 AAGACAGCCAAGACCTTCTGTGG + Intronic
1137270239 16:46898232-46898254 ATGAGTGCAGAGGCCTCCTGGGG + Intronic
1138013329 16:53405058-53405080 AAGAAAGCTAGGGCCTCCTGAGG + Intergenic
1140277359 16:73522625-73522647 AAGAGGGCCTAGGGATCCTGAGG + Intergenic
1141146274 16:81532556-81532578 GGGCAAGCCGAGGCCTCCTGTGG - Intronic
1141628120 16:85272146-85272168 AAGGGAGCCTAGGCTTCCTCGGG - Intergenic
1142506960 17:370601-370623 AAGTCAGCCAAGTCCTCCTGCGG + Intronic
1143191556 17:5043776-5043798 GAGAGAGTCAAGGCCTCCTGAGG - Intronic
1143768514 17:9152892-9152914 AAGAGAGCTGGGGCCTGATGTGG - Intronic
1144795403 17:17888020-17888042 AAGAGTGGCCAGACCTCCTGAGG - Intronic
1144996776 17:19275090-19275112 GGGAGTGCCGAGCCCTCCTGGGG + Intronic
1145270804 17:21403994-21404016 ATGACATCCGAGGCCTCCTGGGG + Intronic
1146277129 17:31523112-31523134 AAGAGGGTCTGGGCCTCCTGAGG - Intronic
1149029117 17:52064047-52064069 AAGAGAGTCTAGGCCTTCTCAGG + Intronic
1152028744 17:77828357-77828379 GAGAGGGCAGAGGCCTCCAGAGG - Intergenic
1152403545 17:80083487-80083509 GAGAGAGCCAAGGCCTTGTGTGG + Intronic
1152519787 17:80848666-80848688 AAGAGAGCCAGTGTCTCCTGAGG - Intronic
1157539057 18:48486339-48486361 AAGAGAGCCAGGCCTTCCTGAGG - Intergenic
1162296705 19:9818847-9818869 AAGAGACCCGAGGGGTCCTGGGG + Exonic
1162497066 19:11029247-11029269 GAGAGGGCCAAGGCTTCCTGAGG + Intronic
1162789489 19:13055557-13055579 AGGAGAGCCGAGGCCCCGTGAGG - Intronic
1166036631 19:40172922-40172944 AAGAGAGCAGAGGAGGCCTGGGG + Intergenic
1166966647 19:46533241-46533263 CCCAGAGCCCAGGCCTCCTGCGG + Intronic
1167903747 19:52641136-52641158 AAGAGGGAGGAGGCCGCCTGGGG - Intronic
1168059484 19:53883076-53883098 CAGAGAGCGCAGGCCCCCTGTGG + Intronic
1168462307 19:56569291-56569313 ATGAGATCCTAGGCCTCATGAGG + Intronic
1168719719 19:58548390-58548412 AAGAGTGCCGAGGCCTTTGGTGG + Exonic
930166648 2:48209941-48209963 AAGAAAGACCAGACCTCCTGGGG - Intergenic
932434460 2:71695043-71695065 AGGGGAGCCGAGGCCCCCAGGGG + Intergenic
932447455 2:71789617-71789639 AAGAGAACAGAGGCTTCATGGGG + Intergenic
934121865 2:88847928-88847950 AACAGATCCCAGCCCTCCTGTGG + Intergenic
938406740 2:131037047-131037069 ATGAGAGCAGTGGCCCCCTGTGG + Intronic
947216974 2:227758567-227758589 ACCAGAGTCGAGGCCACCTGTGG - Intergenic
948524099 2:238559825-238559847 AAGACACCTGAGGACTCCTGCGG - Intergenic
948776946 2:240294132-240294154 GGGAGAGCAGAGGCCTCCGGCGG + Intergenic
1168915369 20:1481051-1481073 AAGAGGGCTGAGGCCTCCCATGG + Intronic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1171360453 20:24583159-24583181 AAGGGAGCCGTGGTCACCTGTGG + Intronic
1172617573 20:36299258-36299280 AAAAGAGCCGAGGACTCGGGTGG + Intergenic
1173249418 20:41356801-41356823 AAGGGAGGCTAGGGCTCCTGTGG + Intronic
1175395001 20:58651599-58651621 TAGAGAGCAGAGACCTCCGGGGG + Exonic
1179467157 21:41583529-41583551 AAGAGGGCCTGGGGCTCCTGAGG + Intergenic
1179564178 21:42236054-42236076 AAGGGAGCCAGGGCCTCCTGGGG + Intronic
1179577708 21:42318156-42318178 TACAGAGCCCAGGGCTCCTGGGG - Intergenic
1181591019 22:23884643-23884665 AAGTGGGACAAGGCCTCCTGCGG - Exonic
1182711733 22:32327522-32327544 GAGAGACCCGAGGCCTGCTGGGG + Intergenic
1183261401 22:36798085-36798107 AAGAAAGCCAAGGCCCTCTGGGG - Intergenic
1184399259 22:44264310-44264332 GAGAGACCCGAGGCCTGCTGGGG + Intronic
949261244 3:2105213-2105235 AAGAGAACCTAGACCTGCTGAGG + Intronic
949280524 3:2341599-2341621 AAGAGGGCCCAGGCACCCTGTGG + Intronic
949834134 3:8249703-8249725 AAAAGAGCCAAGACCTCCAGTGG + Intergenic
951021582 3:17786684-17786706 AAGAAAGCTGAGTCCTCATGTGG - Intronic
951362619 3:21742539-21742561 AACTGAGCCGAGGCCGACTGAGG - Intronic
954415104 3:50389544-50389566 AGGGGAGCCTAGGGCTCCTGAGG - Intronic
956176615 3:66478950-66478972 AAGGGAGCCGAGGCCTGCAGTGG - Intronic
956840892 3:73138758-73138780 GACAGAGCCGTGGCCTTCTGTGG - Intergenic
959476866 3:106822181-106822203 AAGAGAGCTGCGGCCTTTTGGGG + Intergenic
961004065 3:123392883-123392905 AAGAAAGTGGTGGCCTCCTGTGG - Intronic
962423241 3:135246447-135246469 AAGACAGCCGACACCTCCAGGGG + Intronic
964694046 3:159487057-159487079 AACAGAGCAGAGGCCTGCTCAGG + Intronic
966806235 3:183809985-183810007 AAGTGAGCCAGGGCCTCCTGTGG + Intronic
967297152 3:187976102-187976124 AGCACAGCCCAGGCCTCCTGGGG + Intergenic
967980728 3:195063556-195063578 CAGAGAGGTGAGGGCTCCTGGGG + Intergenic
968008716 3:195259728-195259750 AAAAGACCCGAGGCCGCCAGAGG - Intronic
968646980 4:1746081-1746103 CAGAGGGCCAGGGCCTCCTGAGG + Intergenic
968748705 4:2374954-2374976 GACAGAGCCCAGTCCTCCTGTGG + Intronic
968810087 4:2795866-2795888 AAGAATGCAGAGGCCTTCTGGGG - Intronic
968873782 4:3254758-3254780 GAGAGAGCCCAGGCCTCTTGTGG + Intronic
970027170 4:11635889-11635911 AAGGGAGCAGATGCCTTCTGCGG + Intergenic
974362080 4:60894268-60894290 ATGAGAGCCTAGGCATTCTGTGG + Intergenic
983981264 4:174000279-174000301 AAGGGAGCTTTGGCCTCCTGAGG + Intergenic
985939829 5:3126697-3126719 GAGACAGCCGAGCTCTCCTGAGG - Intergenic
986607639 5:9538011-9538033 AAGAGAGCTGAGGAAGCCTGTGG + Intronic
989641876 5:43590566-43590588 AAGAGAACAGAGGACTCATGGGG + Intergenic
990055576 5:51572735-51572757 ATGAGAGTAGAGGCCTCATGGGG - Intergenic
990615589 5:57504197-57504219 AAGACAGCACAGGCCTTCTGAGG + Intergenic
991452815 5:66770863-66770885 AAGAGAAACTGGGCCTCCTGTGG - Intronic
995724601 5:115170006-115170028 AAAAGAGGCGGGGCCGCCTGGGG + Intronic
996221252 5:120935802-120935824 TATAGATCTGAGGCCTCCTGGGG + Intergenic
1001444795 5:171774925-171774947 AAGACAGCTGGGGTCTCCTGAGG - Intergenic
1001682779 5:173570896-173570918 AGGAGAGCCGAGGCCGCAGGTGG - Intergenic
1002774659 6:318510-318532 CTGAGAGCTGAGGCCTGCTGTGG - Intronic
1002774670 6:318548-318570 CTGAGAGCTGAGGCCTGCTGTGG - Intronic
1002774684 6:318596-318618 CTGAGAGCTGAGGCCTGCTGTGG - Intronic
1003849666 6:10208921-10208943 AAGAGAGCTGAGGCCAGCTGGGG - Intronic
1006592786 6:35170421-35170443 AAGAGAGCCAGGGCCTGCTGGGG + Intergenic
1007404203 6:41624268-41624290 AAGAGAGCCTAGGGCTATTGGGG - Intergenic
1008541210 6:52547753-52547775 AGGAGACCGGAGGCCTCCCGTGG - Intronic
1012473018 6:99591314-99591336 AAGAGAGCCCTGGCTTCCTCAGG - Intergenic
1017014857 6:150091792-150091814 CAGGGAGCCGTGGACTCCTGTGG - Intergenic
1018690880 6:166342941-166342963 CGGAGAGCGGAGGGCTCCTGCGG + Intergenic
1020124502 7:5525972-5525994 TTGAGAGTCCAGGCCTCCTGGGG + Intergenic
1022513993 7:30964016-30964038 AAGATAGCCAAGGCTTACTGAGG + Exonic
1026483920 7:70801400-70801422 GAGAGAGCAGAGGCTCCCTGAGG - Intergenic
1030943207 7:115681407-115681429 AAGAGAACCGTGGCTTCCTGAGG + Intergenic
1032083281 7:128870462-128870484 AAGAGAGCCGAGGCCTCCTGGGG - Intronic
1035325763 7:158064860-158064882 AGGAGTGCCAGGGCCTCCTGGGG + Intronic
1036183002 8:6601029-6601051 AGGAGAGCTGAGGCTCCCTGTGG + Intronic
1036993895 8:13631811-13631833 AAAAGAGCCCAGGTCCCCTGCGG - Intergenic
1037611288 8:20478359-20478381 AAGAGCGCCGAGGACTGCTGGGG + Intergenic
1039542415 8:38382651-38382673 TAGAGAGCCGAGTCACCCTGAGG - Intergenic
1039724803 8:40204508-40204530 AAGAGGGGAGAGGCCTTCTGAGG + Intergenic
1042564684 8:70100155-70100177 AGGGAAGCCAAGGCCTCCTGAGG - Intergenic
1044049238 8:87479376-87479398 GAGAGAGCTGAGCCCTTCTGAGG + Intronic
1044837479 8:96310450-96310472 AAGAGAGCCAAGGCCGGGTGCGG - Intronic
1045222688 8:100213730-100213752 AAGACGGCCGAGGTCTCCGGTGG - Intronic
1046716426 8:117572758-117572780 AACAGAACAGAGGCCTCATGGGG + Intergenic
1047434344 8:124823523-124823545 CAGGGAGGCGAGGCCACCTGGGG + Intergenic
1048108578 8:131441050-131441072 AAGTGTGCAGAGGCCTCCTATGG - Intergenic
1048445464 8:134489635-134489657 GAGAGAGAAGAGCCCTCCTGGGG - Intronic
1048811924 8:138296233-138296255 AAGCCAGCCGAGGCCTTCTGAGG - Intronic
1054388485 9:64587781-64587803 AAAAGGACCAAGGCCTCCTGAGG - Intergenic
1055568605 9:77593622-77593644 AGGAGATGCAAGGCCTCCTGGGG + Intronic
1057083342 9:92188738-92188760 AAGAGAGCAGAGGCCTCACTGGG - Intergenic
1058824071 9:108759307-108759329 AAGAGAGCCAGCTCCTCCTGGGG - Intergenic
1059644266 9:116248967-116248989 AAGAGAGCTGAGGCCCCAAGAGG - Intronic
1061052764 9:128205870-128205892 CAGAGGGCCCAGGCCTCCTGGGG - Intronic
1061587644 9:131579054-131579076 AAATGAGTGGAGGCCTCCTGGGG - Exonic
1062277454 9:135737573-135737595 AGAAGAGCCGGGGACTCCTGGGG + Intronic
1187210257 X:17223235-17223257 AAGAGAGGTAAAGCCTCCTGGGG - Intergenic
1193325822 X:80177713-80177735 AAGAAAGCAGAGGCCTAATGGGG + Intergenic
1193771273 X:85590788-85590810 AAAAGAGCCTAGGTCTTCTGTGG - Intergenic