ID: 1032085226

View in Genome Browser
Species Human (GRCh38)
Location 7:128880230-128880252
Sequence GCACCACATCGTGGTCGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 29}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032085224_1032085226 -5 Left 1032085224 7:128880212-128880234 CCTGTGAGTGAGGTCAGGGCACC 0: 1
1: 0
2: 1
3: 14
4: 276
Right 1032085226 7:128880230-128880252 GCACCACATCGTGGTCGCACTGG 0: 1
1: 0
2: 0
3: 2
4: 29
1032085223_1032085226 -4 Left 1032085223 7:128880211-128880233 CCCTGTGAGTGAGGTCAGGGCAC 0: 1
1: 0
2: 0
3: 25
4: 165
Right 1032085226 7:128880230-128880252 GCACCACATCGTGGTCGCACTGG 0: 1
1: 0
2: 0
3: 2
4: 29
1032085215_1032085226 28 Left 1032085215 7:128880179-128880201 CCAGGGATCTCCAGGACTCTGGC 0: 1
1: 0
2: 2
3: 25
4: 263
Right 1032085226 7:128880230-128880252 GCACCACATCGTGGTCGCACTGG 0: 1
1: 0
2: 0
3: 2
4: 29
1032085220_1032085226 3 Left 1032085220 7:128880204-128880226 CCAGGCTCCCTGTGAGTGAGGTC 0: 1
1: 0
2: 3
3: 17
4: 174
Right 1032085226 7:128880230-128880252 GCACCACATCGTGGTCGCACTGG 0: 1
1: 0
2: 0
3: 2
4: 29
1032085219_1032085226 4 Left 1032085219 7:128880203-128880225 CCCAGGCTCCCTGTGAGTGAGGT 0: 1
1: 0
2: 0
3: 23
4: 187
Right 1032085226 7:128880230-128880252 GCACCACATCGTGGTCGCACTGG 0: 1
1: 0
2: 0
3: 2
4: 29
1032085217_1032085226 18 Left 1032085217 7:128880189-128880211 CCAGGACTCTGGCTCCCAGGCTC 0: 1
1: 0
2: 3
3: 58
4: 643
Right 1032085226 7:128880230-128880252 GCACCACATCGTGGTCGCACTGG 0: 1
1: 0
2: 0
3: 2
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032085226 Original CRISPR GCACCACATCGTGGTCGCAC TGG Intronic
902602088 1:17546991-17547013 GCACCACATTCTGCTCGCCCCGG + Intronic
911721306 1:101194160-101194182 GGACTACATGGTGGTCACACAGG + Intergenic
916808046 1:168279370-168279392 CCACCACATTCTGGTCACACTGG + Intergenic
1065388689 10:25159659-25159681 GCAGCACAGCCTGGTCCCACAGG - Intergenic
1065965567 10:30767823-30767845 GCACCACATGGAGGTTGCCCCGG - Intergenic
1084212084 11:67629008-67629030 GCACCACATCTTGGTCAGCCGGG + Exonic
1092310253 12:7344434-7344456 GTACCACATCCTGGGCACACTGG + Intergenic
1122638124 14:103139596-103139618 GAACAACATCGTGGTGACACAGG - Intergenic
1132720076 16:1311437-1311459 GCACCACGGGGTGGTCTCACAGG - Intronic
1137359147 16:47797362-47797384 GCACCACATAGTGGTGGCTCTGG + Intergenic
1140734624 16:77887324-77887346 GTACCACATCCTGGTCCCAAGGG + Intronic
1154194449 18:12255074-12255096 GCACCCGCTCGTGGTCGAACAGG + Intronic
1156204670 18:34872754-34872776 GCACCACAAGGTGGTCCTACTGG + Intronic
948519104 2:238524332-238524354 GCACCACATCATGTTGGCATGGG - Intergenic
1171286819 20:23946429-23946451 GGACCACATTGTGGTCACTCTGG - Intergenic
1180167789 21:46038995-46039017 GCACCACATCAGGGTCTCACTGG + Intergenic
1184260396 22:43312065-43312087 GCACCAGAAAGTGGTAGCACGGG - Intronic
1185105621 22:48867991-48868013 GCACCCCCTCAGGGTCGCACAGG - Intergenic
950433895 3:12967443-12967465 GCACCACATGGCGGCCGCAGTGG + Exonic
966305590 3:178530375-178530397 GACCCAAATCGTGGTCGTACTGG + Intronic
966424819 3:179769992-179770014 GGGCCACATCCTGGTCACACTGG + Intronic
973131512 4:46653886-46653908 GCACCACATAGAGTTCTCACTGG - Intergenic
985497562 5:218280-218302 GCACCACACCGGGGTCGAGCTGG - Exonic
988354110 5:30151076-30151098 GTCCCACATCCTGGTCACACTGG + Intergenic
1012859309 6:104540483-104540505 GCTCCACATCCTGGGCACACTGG + Intergenic
1019053789 6:169205469-169205491 GCACCTCAGCTTGGGCGCACTGG - Intergenic
1028084285 7:86617253-86617275 GCCTCACATCCTGGTCACACTGG - Intergenic
1028909153 7:96188431-96188453 GCAACCCATTGTGGTCACACTGG + Intronic
1032085226 7:128880230-128880252 GCACCACATCGTGGTCGCACTGG + Intronic
1046834624 8:118786307-118786329 GCAAGACATCTTGGTCTCACAGG - Intergenic
1049831954 8:144706298-144706320 ACTCCACATTGTGGTCACACGGG + Intergenic
1197472738 X:126882972-126882994 GCTCCACATCCTGGGCACACTGG - Intergenic