ID: 1032085643

View in Genome Browser
Species Human (GRCh38)
Location 7:128882081-128882103
Sequence TCCCCATGCACTGTGTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 240}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032085634_1032085643 25 Left 1032085634 7:128882033-128882055 CCAGAGTGCGGGACAGAAAGAGG 0: 1
1: 0
2: 0
3: 23
4: 267
Right 1032085643 7:128882081-128882103 TCCCCATGCACTGTGTCCCCAGG 0: 1
1: 0
2: 3
3: 25
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032085643 Original CRISPR TCCCCATGCACTGTGTCCCC AGG Intronic
901510242 1:9714798-9714820 TCTCCATGGAGTGTGTGCCCTGG - Intronic
905176696 1:36140654-36140676 TCCCCATGGACTGGGCCCCTGGG - Intronic
905365646 1:37449815-37449837 TCGCCATGCAGTTTGTCCCCAGG - Intergenic
906033544 1:42737648-42737670 TTTGCATGCACTGTGTCACCTGG - Intronic
907651864 1:56302818-56302840 TCACCATGCTCTGTGCCCCAGGG - Intergenic
908806496 1:67938032-67938054 GCCCCATGCACAGTGTCAGCAGG + Intergenic
909158171 1:72108157-72108179 TCACCTTGCACTGTGCCCTCAGG + Intronic
910697332 1:90033380-90033402 TCCCCCTGAATTGTTTCCCCAGG - Intronic
912490374 1:110059493-110059515 TCCCCATGGGCTGGGACCCCAGG - Intronic
915758119 1:158282789-158282811 TCCCCAGGTACTCTGTCCCAGGG + Intergenic
916985966 1:170191692-170191714 TCCCCAGGCACTCTATCCCAGGG + Intergenic
917091782 1:171360064-171360086 CCCCCATGCACTCTGTCCCAGGG - Intergenic
917624478 1:176831599-176831621 TCCCCATGCAGTCTCTCCTCTGG - Intronic
919502272 1:198351997-198352019 TCCCCATCCACGGTGTAACCAGG + Intergenic
919568855 1:199221404-199221426 TGCCAAGGCACTGTTTCCCCAGG + Intergenic
920635685 1:207700764-207700786 TTCCTCAGCACTGTGTCCCCAGG + Intronic
923623422 1:235595573-235595595 TCCCCATCCACCCTGTCCCATGG + Intronic
1062764294 10:49082-49104 TGCCCATGCATTGCGGCCCCTGG - Intronic
1065804060 10:29378722-29378744 TTCACATGCACTCTGTCCCCAGG - Intergenic
1068123161 10:52805787-52805809 TCCCCATGCCCTGTGTTTTCCGG + Intergenic
1070487674 10:76946180-76946202 TCCACATGCTCTGTGTCTTCAGG + Intronic
1071816156 10:89234299-89234321 TTCCTATTCCCTGTGTCCCCAGG - Intronic
1072417379 10:95260533-95260555 TCCCCCTCCACTGTGTGCACTGG + Intronic
1073803064 10:107064982-107065004 CCCCCAAGCACTGTTTCCCTGGG + Intronic
1074872580 10:117588684-117588706 TCCCCATACACAGTGTGCACAGG - Intergenic
1074903629 10:117840775-117840797 ACCACATACACTGTGTCCCAGGG - Intergenic
1075072593 10:119328608-119328630 AACCCATTCACTGTGGCCCCAGG + Intronic
1077061041 11:617981-618003 TCCACAAGCACTATGGCCCCCGG - Exonic
1077216059 11:1395598-1395620 TCCCCACCCACTGTGGCCCTGGG + Intronic
1077378701 11:2217823-2217845 TCCTCATGCCCTGTGCCCACTGG + Intergenic
1078399833 11:11016127-11016149 TCCCTATGTACTTTGTCCCCAGG + Intergenic
1080513750 11:33001080-33001102 TCCCCAGGGACTCTGTCCCAGGG + Intergenic
1083716719 11:64581666-64581688 TCCCCATGGGCTGTCACCCCAGG - Intergenic
1084103434 11:66965096-66965118 TTTCCCTGCACTGTGTTCCCAGG - Intergenic
1084316994 11:68351368-68351390 TCCCCCTGCACTGTGGCTCCAGG + Intronic
1084913994 11:72414133-72414155 TCCCCAGGCAGTGTGTGCCAAGG + Intronic
1086484738 11:87286551-87286573 GCCCCCTGCTCTGTGGCCCCCGG - Intronic
1087014513 11:93542901-93542923 GCCCTTTGCACTGCGTCCCCCGG + Intronic
1088702588 11:112426587-112426609 CCCCCAGGCACTCTGTCCCAGGG - Intergenic
1089786642 11:120912108-120912130 TCCACATCCACTGGGTCCCCTGG - Intronic
1090283875 11:125481804-125481826 GCTCCATGCACTTTCTCCCCTGG - Intronic
1091118560 11:133038135-133038157 TCCCCATGCACTCGGTTCCCAGG - Intronic
1092174587 12:6394418-6394440 CTCCCATCCACTGTGTCCACTGG - Intergenic
1092312142 12:7369388-7369410 TCCACAGTCACTCTGTCCCCAGG + Exonic
1096864894 12:54556664-54556686 TCTCCATGCCCTATGCCCCCAGG - Intronic
1097412164 12:59268429-59268451 CCCCCAGGCACTGTGTCTCAGGG - Intergenic
1099030875 12:77524313-77524335 TCCCCAGGTACTCTGTCCCAGGG - Intergenic
1100341465 12:93683546-93683568 TCCCCATAGACTCTGTGCCCTGG + Intronic
1100397370 12:94196721-94196743 TACCCATGCACACTGTCTCCTGG - Intronic
1101329489 12:103745997-103746019 TCGCCATGCCCTGTGACCCCAGG - Intronic
1102760346 12:115379772-115379794 TCCCTATTCACTGTGGCCCTTGG - Intergenic
1102907498 12:116688043-116688065 TTCCCCTGCACTGAGTCTCCTGG - Intergenic
1102963636 12:117110307-117110329 TCCCCAGCCACTGTGTCCATGGG - Intergenic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1114600566 14:23953031-23953053 TCCCTAACCACTCTGTCCCCAGG - Intergenic
1114604800 14:23988175-23988197 TCCCTAACCACTCTGTCCCCAGG - Intronic
1114610250 14:24035741-24035763 TCCCTAACCACTCTGTCCCCAGG - Intergenic
1114844932 14:26309442-26309464 TCCCCAGGTACTCTGTCCCAGGG - Intergenic
1118149970 14:63178973-63178995 TTGCCAAGCACTGTGTCCACAGG - Intergenic
1118331177 14:64817182-64817204 TGCCCCTGCACTGTGTGGCCCGG - Intronic
1118678733 14:68217009-68217031 TCCCCAAGTCCTGTGTCCTCTGG + Intronic
1120164937 14:81187521-81187543 TCCCCATTCTCCCTGTCCCCTGG + Intronic
1121309303 14:92926583-92926605 TGCCCCTGCACTGTGTTCCCAGG + Exonic
1122287016 14:100658297-100658319 ACACCCTGCACTGTGGCCCCAGG - Intergenic
1123026466 14:105426588-105426610 GGCCCAGGCACTGTGTCTCCTGG - Intronic
1124137338 15:27046428-27046450 TCCCCTTACTCAGTGTCCCCTGG + Intronic
1124707603 15:31978390-31978412 GCCCCATACCCTGTGTCCCCAGG - Intergenic
1129515022 15:76152115-76152137 TCACCAGCCACTGTATCCCCTGG + Intronic
1129971423 15:79780869-79780891 TCCCCAGGCACTGTGTCCCAGGG - Intergenic
1130034323 15:80343288-80343310 TCACCTTGCACTGTGCCCTCTGG + Intergenic
1132522695 16:398781-398803 ACCCAAGGCAATGTGTCCCCAGG - Intronic
1132598452 16:763620-763642 TCAGCAGGCCCTGTGTCCCCAGG + Exonic
1133132891 16:3688740-3688762 TCCCAAAGCACTGAGTTCCCAGG + Intronic
1133699503 16:8295849-8295871 TCCACATGCAAAGTCTCCCCAGG + Intergenic
1134292500 16:12913668-12913690 TCTCCCCTCACTGTGTCCCCTGG + Intronic
1135935957 16:26780220-26780242 TCCCTGTGGACTGTCTCCCCTGG + Intergenic
1137540832 16:49360504-49360526 TCCCCCTGCACTGGTCCCCCTGG + Intergenic
1137739334 16:50751754-50751776 TCGACCTGCATTGTGTCCCCAGG - Exonic
1138558913 16:57788473-57788495 TCCCCATGCCCTGTCCTCCCCGG - Intronic
1138607590 16:58098812-58098834 TCTCCATGGACTGTCTGCCCCGG - Intergenic
1140335481 16:74100897-74100919 TCTACATTCACTGTGTTCCCAGG - Intergenic
1140634009 16:76889171-76889193 TCCTCATGCTCTGCCTCCCCTGG - Intergenic
1141089089 16:81117636-81117658 CCCCCATGCACAGAGTGCCCAGG + Intergenic
1141118182 16:81329793-81329815 TCACCCTGCACTGTCTCCCACGG + Intronic
1142061611 16:88033680-88033702 TTCCCATGCAGCGTGTCCCTTGG + Intronic
1142685041 17:1572701-1572723 TCCCCAAGCACTGTTGGCCCTGG + Intronic
1142687835 17:1587927-1587949 TCCCCAAGCACTGTTGGCCCTGG + Intronic
1142865805 17:2790810-2790832 AGCCCCTCCACTGTGTCCCCTGG - Intronic
1143352092 17:6296528-6296550 TCTCCAAGCCCTGTGTCCCGAGG + Intergenic
1143622896 17:8091199-8091221 CCCCTTTGCCCTGTGTCCCCAGG + Intergenic
1143865140 17:9917953-9917975 TCCCCAGGCCCCGTGTCGCCCGG + Intronic
1144735467 17:17553109-17553131 TCCCCACACACGGTGTCCTCAGG + Intronic
1145939885 17:28737797-28737819 TCCCCATGCACTGTACCTGCAGG + Exonic
1146306479 17:31733491-31733513 TCTCCATGCACAGTGGCTCCAGG + Intergenic
1147162914 17:38578403-38578425 ACCCCGTGCTCCGTGTCCCCAGG - Intronic
1147602639 17:41755588-41755610 TCCCCAAGCACGGTGTGCCCTGG - Exonic
1147838954 17:43356702-43356724 TCCCCGTGCACAGTGTCAGCAGG - Intergenic
1147922577 17:43927147-43927169 TCCCCATGCGCTTACTCCCCCGG - Intergenic
1148772633 17:50076079-50076101 TCCCCATCCACAGGGTCTCCAGG - Intronic
1150229896 17:63544134-63544156 TCCTCACACCCTGTGTCCCCAGG + Intronic
1152072520 17:78140963-78140985 TGCCCATGCCCTGGCTCCCCGGG + Exonic
1152430871 17:80247758-80247780 AGCCCGTGCACTTTGTCCCCAGG + Intronic
1152473919 17:80505282-80505304 TCTCCAGACACTGTGTCCCTAGG - Intergenic
1153763726 18:8355439-8355461 TCCCCATTCCCTATCTCCCCTGG - Intronic
1154247573 18:12713322-12713344 TCCTGATGCACTGTGACACCAGG + Intronic
1155021338 18:21899895-21899917 TCCCTATACACTGTGTCCTATGG - Intergenic
1155355135 18:24944489-24944511 TCCCCTTTCACTGTTTTCCCAGG - Intergenic
1156116665 18:33794244-33794266 TAGGCAGGCACTGTGTCCCCAGG - Intergenic
1158390812 18:57043544-57043566 CCACCATTCACTGTGTCCCAAGG + Intergenic
1158412727 18:57222085-57222107 TGCCCCTGCTCTGTGTCCCCAGG + Intergenic
1158585154 18:58726427-58726449 CCCTCAAGCACTGAGTCCCCTGG - Intronic
1159029756 18:63218816-63218838 TCCCCATCCACTCTGTCCCTTGG + Intronic
1161167549 19:2796465-2796487 TCCCCATGCCCAGTGCTCCCTGG - Intronic
1161222389 19:3123618-3123640 AACCCATGCCCTGGGTCCCCCGG + Exonic
1161375594 19:3937765-3937787 TCCCCGTCCACTGTCCCCCCGGG + Intronic
1161375612 19:3937811-3937833 TCCCCGTCCACTGTCCCCCCGGG + Intronic
1161375630 19:3937857-3937879 TCCCCGTCCACTGTTCCCCCGGG + Intronic
1161375647 19:3937903-3937925 TCCCCGTCCACTGTTCCCCCGGG + Intronic
1161375664 19:3937949-3937971 TCCCCGTCCACTGTCCCCCCGGG + Intronic
1161375682 19:3937995-3938017 TCCCCCTCCACTGTCCCCCCGGG + Intronic
1161375699 19:3938041-3938063 TCCCCGTCCACTGTCCCCCCGGG + Intronic
1161375731 19:3938133-3938155 TCCCCGTCCACTGTCCCCCCGGG + Intronic
1161375763 19:3938225-3938247 TCCCCGTCCACTGTCCCCCCGGG + Intronic
1161375798 19:3938316-3938338 TCCCCGTCCACTGTTCCCCCGGG + Intronic
1161375830 19:3938407-3938429 TCCCCGTCCACTGTTCCCCCGGG + Intronic
1161375846 19:3938453-3938475 TCCCCGTCCACTGTCCCCCCGGG + Intronic
1161556047 19:4943311-4943333 GCCCCCTGCACTCTGTTCCCTGG - Intronic
1162462953 19:10824106-10824128 ACCCCATCCCCTGTGTGCCCCGG - Intronic
1165816105 19:38643276-38643298 TCCCCAGACACTGAGTCCCTAGG - Intergenic
1166633730 19:44431069-44431091 TCTCCCTGCACTGTGTCTCAGGG + Intronic
1166960058 19:46491874-46491896 TCCCTGTGCCCTGTGTCACCTGG - Exonic
1167135713 19:47614040-47614062 TCCTCCTGGACTGTGTCCCAAGG - Intronic
1167368240 19:49065602-49065624 CCCACATCCACTGTCTCCCCGGG - Intergenic
925151373 2:1617778-1617800 TCCCCAGGCACCGTCTCCCCAGG + Intergenic
926775568 2:16419184-16419206 TCCCCATGCACTGTATTACCAGG + Intergenic
927370612 2:22350947-22350969 TCACAAAGCACTCTGTCCCCTGG + Intergenic
927398837 2:22687302-22687324 TTCCCATGCAATGTGTTCCAAGG + Intergenic
927885282 2:26714444-26714466 TCCCCAAGCACTGTGTCCCAGGG - Intronic
933173957 2:79156266-79156288 GCCCCAGGCTCTGTGACCCCAGG - Intergenic
934713804 2:96531768-96531790 TTTCCATTCCCTGTGTCCCCAGG + Intergenic
935602976 2:104941515-104941537 TCTCCCTGCACTGTGTCTGCAGG + Intergenic
935691572 2:105736592-105736614 TCCCTATGCCCTGAGGCCCCTGG + Intergenic
935885015 2:107608275-107608297 TACTCATGCACAGAGTCCCCAGG - Intergenic
936047394 2:109198053-109198075 TCCCCATGCAGTGTGTCAGTTGG + Intronic
937651674 2:124326200-124326222 TCCCCATGCACAGGCTCCCTGGG - Intronic
938966610 2:136394331-136394353 TCCCCAAGCACGGTGTGCCACGG + Intergenic
939215849 2:139237226-139237248 TCACCCTGCTCTGTGTGCCCTGG - Intergenic
939365517 2:141225408-141225430 TCTCTATGCACTTTGTCCCGAGG + Intronic
945261554 2:207848435-207848457 TCTCCATGCACTGTGCCCAGGGG + Intronic
946336241 2:219038539-219038561 TCCCTTTGGACTGTGTCCCAAGG - Exonic
947525776 2:230875851-230875873 TCCCCTTGCCCTGAGTCCCCGGG - Intronic
947955984 2:234192086-234192108 TCCCACTGCCCTGTCTCCCCTGG + Intergenic
948143252 2:235690105-235690127 TCCCCAGGTGCTGAGTCCCCAGG + Intronic
948334128 2:237194338-237194360 CCTCCATGTTCTGTGTCCCCAGG - Intergenic
948466354 2:238153541-238153563 TCCACCTGTTCTGTGTCCCCAGG - Intergenic
948883921 2:240873703-240873725 ACCCCAGGCACCGTGTCCCTGGG - Intronic
1175148793 20:56916717-56916739 TTCCCAACCACTGTGTCACCGGG - Intergenic
1176064353 20:63187076-63187098 TCCCAGTACCCTGTGTCCCCTGG + Intergenic
1180843272 22:18969103-18969125 CCCCCAGCCACTCTGTCCCCTGG - Intergenic
1181058198 22:20269632-20269654 CCCCCAGCCACTCTGTCCCCTGG + Intronic
1181278671 22:21703280-21703302 TCCCCGTGCAGTGTGGCCCATGG - Intronic
1181405516 22:22681798-22681820 TTCCCCTGCTCTCTGTCCCCAGG + Intergenic
1181507249 22:23367969-23367991 TTCCCAGGCACTGTGTCTCAGGG - Intergenic
1181522917 22:23459779-23459801 GCCTCCTGCCCTGTGTCCCCTGG + Intergenic
1181540385 22:23569861-23569883 TCGCCATAAACTGTGTCCCTTGG - Intergenic
1182952449 22:34390425-34390447 TCCCCAGGTACTCTGTCCCAGGG + Intergenic
1183074626 22:35419193-35419215 TCCCTCTGCACTAAGTCCCCAGG + Intronic
1184235025 22:43178764-43178786 TCCCCCTGCTGTGTGACCCCTGG + Intronic
1184339934 22:43880611-43880633 TCCCCGGTCACTGTGTACCCAGG - Exonic
1185182797 22:49372861-49372883 TCCCCACCCTCTCTGTCCCCAGG + Intergenic
1185345973 22:50310970-50310992 TCCCCCAGCCCTGTGTCCCCTGG + Exonic
949268687 3:2189206-2189228 TCCACATGCAGGGTGTGCCCAGG + Intronic
950078749 3:10206247-10206269 TCCCCAGGCACTGTGTGCAGAGG - Intronic
950118124 3:10464331-10464353 TCCCCTGGGCCTGTGTCCCCTGG - Intronic
950622615 3:14217818-14217840 TTGCCATGCACTGGGTCCCTTGG - Intergenic
950673348 3:14540135-14540157 TCCCCAAGCCCTGGGTCTCCAGG + Intronic
952924185 3:38309223-38309245 TCCACATGCACTTTCTCCCAGGG - Intronic
953561998 3:43999045-43999067 TCCGCCTTCTCTGTGTCCCCCGG + Intergenic
954155186 3:48681490-48681512 TCCCCAGGCTCAGTGTACCCAGG + Exonic
955224607 3:57050450-57050472 TACCCCTGTACTGTGTGCCCTGG - Intronic
955622276 3:60877435-60877457 TGCCAAAGCACTGTTTCCCCAGG - Intronic
957811548 3:85228933-85228955 TCCCCAGGTACTCTGTCCCAGGG + Intronic
961819500 3:129567981-129568003 TCCCCAAGCCCTCTGTCCACGGG - Intronic
965539041 3:169853979-169854001 TGCCCATGCTCTCTCTCCCCAGG - Intronic
966818058 3:183905360-183905382 TCTCCTTGCTCTGTGGCCCCAGG - Intergenic
967194135 3:187012067-187012089 TCCCCACTCACTGTTTGCCCAGG + Intronic
968425297 4:519281-519303 TCGCCATGCTGTGTCTCCCCTGG + Intronic
968903179 4:3440617-3440639 TCCACATTCACCGTGCCCCCAGG + Intergenic
968903215 4:3440706-3440728 TCCACATTCACCGTGCCCCCAGG + Intergenic
968903264 4:3440813-3440835 CCCCCATTCACCGTGCCCCCAGG + Intergenic
968903278 4:3440848-3440870 TCCATGTGCACTGTGCCCCCTGG + Intergenic
970763475 4:19518579-19518601 TCCCTAGGCTCTGTGTCCCAGGG + Intergenic
971355361 4:25890386-25890408 TCACCTTGCTGTGTGTCCCCCGG + Intronic
972255840 4:37354456-37354478 CCCCCAGGCACTCTGTCCCAGGG + Intronic
972321777 4:37978346-37978368 ACCCCATGCACTCAGTCCCTTGG + Intronic
973712262 4:53641683-53641705 TCCCCATTCACCAGGTCCCCAGG + Intronic
973757798 4:54092390-54092412 GCCTCCTGCCCTGTGTCCCCGGG - Intronic
974014287 4:56634781-56634803 CCACCATCCACTTTGTCCCCTGG + Intergenic
974186838 4:58457259-58457281 GCCCCATGCTCTGTGGCACCTGG + Intergenic
976167651 4:82272300-82272322 TCCCCAGGTGCTCTGTCCCCAGG - Intergenic
976388486 4:84485174-84485196 TGAGCATGCACAGTGTCCCCAGG + Intergenic
978522541 4:109631723-109631745 CCACCATGCATTGTCTCCCCAGG - Intronic
979470385 4:121089687-121089709 TCACCATGCCCTGTGCTCCCCGG + Intergenic
984446987 4:179849400-179849422 GCACCATACTCTGTGTCCCCTGG - Intergenic
985575043 5:670065-670087 TTCCCAGGCTCTGAGTCCCCTGG + Intronic
985668794 5:1195884-1195906 TGGCCATCAACTGTGTCCCCAGG - Intergenic
985866290 5:2517079-2517101 GCCCCTTGCACTGAGGCCCCAGG + Intergenic
986605708 5:9521045-9521067 TTCCTATGCACTCTGTGCCCAGG - Intronic
987303297 5:16616568-16616590 TCCCCCTGCACTGGGTCCCCGGG + Intronic
989997386 5:50852123-50852145 TCCCCATCCACTCAGCCCCCAGG + Intergenic
992123969 5:73622960-73622982 TCCCCATGAGATCTGTCCCCTGG + Intergenic
994719805 5:103367350-103367372 TCCCCATGCACAGTGTCAGCAGG + Intergenic
996426574 5:123319941-123319963 CCCCCAGGCACTCTGTCCCAGGG + Intergenic
997651602 5:135525818-135525840 TCAACATGCCCTGTCTCCCCTGG + Intergenic
998955327 5:147432471-147432493 CCCCCATCCACTGTGACCCAGGG - Intronic
1001132728 5:169078210-169078232 TCCAAATGCAATGTCTCCCCAGG + Intronic
1001263614 5:170255404-170255426 TCCACATGCAGTGTGTGCACGGG - Intronic
1002709895 5:181189123-181189145 TCCCTATGTCCTGTGTCCTCTGG + Intergenic
1006465927 6:34195017-34195039 ACCCCCTGCCCTGTGTCCCTAGG + Intergenic
1006849385 6:37086627-37086649 TCCCCATTCCCTGTTTCCTCCGG + Intergenic
1007107614 6:39294529-39294551 ACTCCATGCGCTGTGTCACCAGG - Intergenic
1008805346 6:55420082-55420104 TTCCCATACACTGTGGCCCTTGG + Intergenic
1010074354 6:71783527-71783549 ACCCCTTGCACAGTGTGCCCTGG - Intergenic
1011120130 6:83942991-83943013 CCCCCAGGCACTCTGTCCCAGGG - Intronic
1011181244 6:84623603-84623625 TACCCAGGCACTATCTCCCCAGG + Intergenic
1013163549 6:107569392-107569414 TCCACATGCACTATGCCCTCTGG - Intronic
1015162972 6:130173806-130173828 CCCCCAGGCACTCTGTCCCATGG + Intronic
1016691491 6:146943219-146943241 TCCCCAGGTACTCTGTCCCAGGG + Intergenic
1018913264 6:168116557-168116579 TCCCCAAGCACTGTGCTCCCTGG + Intergenic
1019056045 6:169224311-169224333 TCCCCATGCAGCCTTTCCCCAGG - Intronic
1026959422 7:74398989-74399011 TCTCCCTGCACTGTGTCCACGGG + Intronic
1026973206 7:74480375-74480397 TGCCCCTGCACTGGGGCCCCTGG - Intronic
1028432811 7:90767112-90767134 CCCCCATGCACAGTGTCAGCAGG + Intronic
1029694281 7:102202762-102202784 TCCCCAAGCTGTGTGTCCCCGGG - Intronic
1029850532 7:103457113-103457135 TCCCCAGGTACTCTGTCCCAGGG + Intergenic
1030870040 7:114744832-114744854 TGCCCATGCACTGTGAACTCTGG - Intergenic
1032013309 7:128360545-128360567 TCCCGAGGCCCTGTGCCCCCTGG - Intronic
1032085643 7:128882081-128882103 TCCCCATGCACTGTGTCCCCAGG + Intronic
1035360843 7:158313418-158313440 TCCCCAGGGACTGTGTGTCCTGG - Intronic
1036430490 8:8685336-8685358 TCGCCATGCACCCAGTCCCCAGG + Intergenic
1045297147 8:100882053-100882075 CCCCCATGCACAGTGTCAGCAGG + Intergenic
1045325997 8:101118165-101118187 TGGCCATGCTCTGTGGCCCCCGG - Intergenic
1048550989 8:135433468-135433490 TCCCTATGTACTGTGGCCCCAGG - Intergenic
1048658281 8:136567911-136567933 TCCCCATTCACTCTTTCTCCTGG - Intergenic
1049340781 8:142111575-142111597 TCCCCCTGCACAGCGTGCCCTGG + Intergenic
1049376119 8:142289998-142290020 CCCCCAGGCACTGTGGGCCCTGG + Intronic
1049544255 8:143222023-143222045 TGCCCCTGGCCTGTGTCCCCAGG + Intergenic
1050135701 9:2461450-2461472 TGCCCTTGCACTTTGTGCCCTGG - Intergenic
1052370551 9:27659758-27659780 GCCCCATGAACTTTGTCCTCTGG + Intergenic
1056087277 9:83162853-83162875 TCCCCTTTGACTGGGTCCCCTGG - Intergenic
1056850135 9:90076702-90076724 CCCACAGGCACTGTGTCCCAGGG + Intergenic
1061134401 9:128724912-128724934 TCCTCCTTCCCTGTGTCCCCAGG + Intergenic
1061276535 9:129572097-129572119 TCACCATAAACTGTGTCCCTAGG - Intergenic
1061724731 9:132575880-132575902 TCCACAGGCACTGTTTCCACAGG + Intergenic
1061781128 9:132996620-132996642 TGCCCCTGCTCTGTGCCCCCAGG - Intergenic
1062116790 9:134813961-134813983 ACCACATGCACTGTCTCCCTAGG + Exonic
1185529284 X:804725-804747 TCCCCAGGGACAGTGTCCCAGGG + Intergenic
1185927018 X:4158511-4158533 GCCCCATGCACTGTTTCTCTCGG - Intergenic
1186236354 X:7515234-7515256 TCACCATCAACTGTGTCCCCTGG + Intergenic
1187851227 X:23593343-23593365 TCCTCATGCCCAGTGTCTCCAGG + Intergenic
1193404513 X:81084433-81084455 TCCCCAGGTACTCTGTCCCAGGG - Intergenic
1195564197 X:106323170-106323192 TACCCATGGACTGAGTCTCCAGG + Intergenic
1197638967 X:128947236-128947258 TAACCATTCACTGTGTCCCCTGG + Intergenic
1198020017 X:132648315-132648337 TCCTCATGCACTGGGACCCACGG - Intronic
1200047481 X:153410510-153410532 TCTCCCTGCACTGGGCCCCCTGG + Intergenic
1200120295 X:153787007-153787029 TCCCCCTGCCCTGAGTGCCCTGG - Intronic
1200137085 X:153880438-153880460 TCACCAGGCACCATGTCCCCAGG - Intronic
1200958395 Y:8973296-8973318 TCCCCATGTACCGTGAACCCAGG + Intergenic
1201462309 Y:14239827-14239849 CCCCCAGGTACTCTGTCCCCAGG - Intergenic