ID: 1032088171

View in Genome Browser
Species Human (GRCh38)
Location 7:128894364-128894386
Sequence ACATCTAATAAGTGGATAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032088171 Original CRISPR ACATCTAATAAGTGGATAGC TGG (reversed) Intronic
903734394 1:25521046-25521068 ACAGCCAATAAGTGGTCAGCTGG - Intergenic
904475107 1:30759840-30759862 ACAGCTACTAAGTGGGGAGCTGG - Intergenic
905561085 1:38927905-38927927 ACAGCTAATAAGGGGAGGGCTGG + Intronic
907270278 1:53287165-53287187 ACACCAATTAAATGGATAGCAGG + Intronic
911231002 1:95361709-95361731 ACAGCTACTAAGTGACTAGCAGG - Intergenic
914967307 1:152271491-152271513 ATATCTAATAATAGGATTGCTGG + Intergenic
914969060 1:152290622-152290644 ATATCTAATAATAGGATTGCTGG - Intergenic
915608109 1:156967718-156967740 ACAGCTAAGGAGCGGATAGCTGG - Intronic
918985617 1:191621731-191621753 CCATCTACAAAATGGATAGCTGG - Intergenic
919132209 1:193465483-193465505 ACATATCATAAGTACATAGCTGG + Intergenic
919221956 1:194640932-194640954 ACACCCAATGATTGGATAGCTGG + Intergenic
1065141737 10:22725015-22725037 AGATCTAAGAAATGGAAAGCAGG - Intergenic
1066679384 10:37922307-37922329 ACATCCAATAATGGGATTGCTGG - Intergenic
1068341929 10:55715562-55715584 AAATCTAAGAAGTGGAAAACAGG - Intergenic
1069274538 10:66572920-66572942 ACATCTGATAAGCAGATGGCAGG - Intronic
1071089340 10:81900262-81900284 ACTTCTTATAAGTGCCTAGCGGG + Intronic
1074919521 10:117993224-117993246 ACATCTAAGAACTGGACACCTGG + Intergenic
1075217407 10:120548588-120548610 ACATCCAATAATGGGATTGCTGG + Intronic
1077619580 11:3708523-3708545 TCATCTAATAAGTGGACAAGGGG + Intronic
1079306968 11:19331945-19331967 ATATCTAGTACGTGGTTAGCTGG + Intergenic
1079370875 11:19851200-19851222 ACAGCTAGTAAGTGGCAAGCTGG + Intronic
1080161306 11:29179894-29179916 ACAACTAATAAGGGCAAAGCTGG - Intergenic
1081096903 11:38947607-38947629 ACATCTAATAATGAGATTGCTGG - Intergenic
1081690778 11:45076348-45076370 ACATCTAATAGGGAGATGGCTGG - Intergenic
1082733665 11:56831406-56831428 ACACCTACTAATGGGATAGCTGG - Intergenic
1083097797 11:60269394-60269416 ATACCTAATAATGGGATAGCTGG + Intergenic
1085833875 11:79931583-79931605 ACAGCTAATAAAGGGAGAGCTGG + Intergenic
1086040028 11:82464903-82464925 ACATCCAATAATAGGATTGCTGG + Intergenic
1086204923 11:84246352-84246374 ACAGCTAATAAGTGAATAAAGGG - Intronic
1087117580 11:94541985-94542007 ACATCAAATAAGGGTATAGTAGG + Intergenic
1087908430 11:103725731-103725753 ACACCCAATAAGGGGATTGCTGG - Intergenic
1089151899 11:116370893-116370915 ACATCTGATATATGGATAGCAGG + Intergenic
1092344484 12:7704160-7704182 ACACCTAAGAAGTGGGTAGTTGG + Intergenic
1095426782 12:42083434-42083456 GCATTTAATAAATGGATAACTGG + Exonic
1095693882 12:45121751-45121773 ACATTTAATCAGTACATAGCTGG - Intergenic
1095783795 12:46088242-46088264 TCATCTAATTAGTGGTTAGCAGG - Intergenic
1098695116 12:73542805-73542827 ACATCTAGTAATGGGATTGCTGG - Intergenic
1100545172 12:95595056-95595078 ACATCTAGTAAGTGCAGAGCAGG + Intergenic
1101885660 12:108659394-108659416 ACATGTACTAATTGTATAGCAGG - Intronic
1101885879 12:108661572-108661594 ACATGTACTAATTGTATAGCAGG + Intronic
1103140362 12:118542701-118542723 ACATCTAATAAGTGACAAGGTGG + Intergenic
1104266599 12:127239145-127239167 TCATCTAGTAAGTTGATTGCTGG + Intergenic
1104521599 12:129480822-129480844 ACATCTCAGAAGTGGATTGCGGG - Intronic
1104727522 12:131087268-131087290 ACATATCTTAAGTGGATAGGAGG + Intronic
1106698479 13:32204006-32204028 ACATTTAGTGAGTGGATAGTAGG + Intronic
1108688422 13:52840945-52840967 TCAACTAATAAGTGAACAGCAGG - Intergenic
1108829760 13:54462957-54462979 ACATCTCAGCAGTGGCTAGCAGG + Intergenic
1118547470 14:66907824-66907846 ACAGTTAATAAATGGATGGCAGG + Intronic
1121800809 14:96772632-96772654 ACTTCAACTAAGTGGATAACGGG + Intergenic
1123783928 15:23649968-23649990 ACAGCTACTAAGTGAATAACAGG - Intergenic
1127101196 15:55566586-55566608 ATATCCAGTAAGGGGATAGCTGG + Intronic
1127136686 15:55931306-55931328 ACAGTTAAAAAGTGGGTAGCAGG + Intronic
1127491953 15:59473370-59473392 ACATCTACTAAGTGACTAACGGG - Intronic
1129013163 15:72441202-72441224 ATATCTAATAATGGGATTGCTGG + Intergenic
1131704641 15:94980011-94980033 ATATCTAATAATGGGATTGCTGG - Intergenic
1133753259 16:8741401-8741423 ACAGCTAGCAAGTGGTTAGCAGG - Intronic
1137897669 16:52231812-52231834 ACAGGTAATAAGTGGTGAGCTGG - Intergenic
1140896085 16:79325483-79325505 ACAGCTAGTAAGTGGAAAGCAGG + Intergenic
1143551573 17:7633537-7633559 CTAACTAATAAGTGGATAGTTGG + Intergenic
1144447546 17:15344870-15344892 ACATCAAATAAATGTATAGGGGG - Intergenic
1147357675 17:39910512-39910534 ACAGCTAGTAAGTGTAGAGCTGG + Intronic
1150750074 17:67853220-67853242 ACATCTCATAATTGGAGAACAGG + Intronic
1154246128 18:12701463-12701485 ACATCTACTAAGTTGAAAGCTGG - Intronic
1157951166 18:52039393-52039415 ACATCTAAGAATAGAATAGCTGG - Intergenic
1158682553 18:59581771-59581793 ACATTTAGTAGGTGGATACCAGG - Intronic
1159711848 18:71770200-71770222 ACATATAATCATTGTATAGCAGG + Intronic
1160258655 18:77269402-77269424 ATATCTATTAAGTGGAAAGAAGG + Exonic
1164681418 19:30136076-30136098 GCATCTAACAATTGGACAGCTGG + Intergenic
1167110786 19:47459846-47459868 GCATCTAAAAGGTGGATAGATGG - Intronic
926658094 2:15431797-15431819 ACATCTACTAACTGGATAGTTGG + Intronic
932515092 2:72338110-72338132 AGAGCTACTAAGTGGAAAGCTGG - Intronic
933822059 2:86122243-86122265 TCATCCAATAAGTGGGAAGCAGG + Intronic
936803146 2:116290911-116290933 ATATCTAGTAATTGGATTGCTGG - Intergenic
937135365 2:119547006-119547028 ACACCTGGTAAGTGGAGAGCTGG + Intronic
937926233 2:127169668-127169690 AAATCAAATAAGTGGATAAGGGG + Intergenic
938422997 2:131158754-131158776 ACAGCTAATAAGGGAATATCTGG - Intronic
938561780 2:132478893-132478915 ACATCTAGTAACTGAACAGCCGG - Intronic
938931781 2:136092911-136092933 ACATGAAATATGTGGATGGCAGG + Intergenic
938977944 2:136496983-136497005 ACATCTGAGAAGAGGAAAGCTGG + Intergenic
1169594915 20:7187664-7187686 ACATCTAATGAGAGTAGAGCAGG - Intergenic
1173844538 20:46179492-46179514 ACATCTCAGAAGTGGACTGCAGG + Intronic
1174267977 20:49345719-49345741 ACATTTAGTAATTGGATCGCCGG + Intergenic
1175279066 20:57790675-57790697 ACAGTTAATAAGAGGATGGCAGG - Intergenic
1177209905 21:18058331-18058353 ACACCTAATAGTTGGATTGCTGG - Intronic
1178158309 21:29880891-29880913 TCATCTGATAAGTGCATAGGTGG + Intronic
1180252109 21:46596667-46596689 TCATCTAATAATTGGATTGCGGG - Intergenic
951058865 3:18180620-18180642 AAATATATTAAGTGGATAGATGG - Intronic
952806858 3:37364118-37364140 ATATATATTAAGTGGATAGGGGG - Intronic
953595986 3:44314486-44314508 ACAACAAATAAGTGTAAAGCAGG + Intronic
963008258 3:140746548-140746570 ACTTCTAATAAGAGGAGAGGAGG - Intergenic
971221669 4:24713333-24713355 ACAACTTATTAGAGGATAGCAGG + Intergenic
974636502 4:64569911-64569933 ACATTTAATAAGTAGAAAACTGG - Intergenic
975163763 4:71153475-71153497 ACATCTAACAGGAGGAGAGCTGG - Intergenic
975777412 4:77802793-77802815 ACAGCTAGTAAGTGGCTAGACGG + Intronic
976628824 4:87216993-87217015 ACAGCCAATAAGTGGAGATCTGG + Intronic
976715840 4:88121911-88121933 ACAGCAAATAAGTGGATACCTGG + Intronic
977208444 4:94190565-94190587 AAATCCAATCAGTGGCTAGCAGG + Intergenic
977370927 4:96134660-96134682 ACTGCCAATAAATGGATAGCAGG + Intergenic
977401090 4:96533303-96533325 ACATGAAAAAAGTGGATAGAAGG - Intergenic
981339112 4:143599886-143599908 ACATTTCATGTGTGGATAGCTGG - Intronic
981564903 4:146090010-146090032 ACATCTACTAAAGGGATAGTGGG + Intergenic
989770850 5:45143550-45143572 ATATCTAATAATGGGATTGCTGG + Intergenic
990765037 5:59173048-59173070 ACAACTACTAAGAGGAAAGCTGG + Intronic
993418745 5:87672495-87672517 ACATCTACTAAGTTGAAAGTTGG + Intergenic
994927619 5:106138655-106138677 ATATCCAATAAAGGGATAGCTGG + Intergenic
999649494 5:153751319-153751341 AGAACTAATAACTGGATAGATGG + Intronic
1000708673 5:164544010-164544032 ACATCTAATAAGAAAATGGCAGG - Intergenic
1004541831 6:16557984-16558006 ACATAGATTAAGTGGATACCAGG + Intronic
1004937803 6:20525191-20525213 ACACCTAGTAATGGGATAGCTGG - Intergenic
1009997344 6:70910685-70910707 ATACCCAATAAGTGGATGGCTGG + Intronic
1011620655 6:89239375-89239397 AGAGCAAATAAGTGGATAACTGG - Intergenic
1011712002 6:90064636-90064658 CCAGCTAATAAGTGGGTAGTAGG + Intronic
1012507306 6:99962202-99962224 ACAGCTACTAAGTGACTAGCAGG + Intronic
1013426210 6:110015349-110015371 ACATCTTATTAGTGCATAGGTGG - Intergenic
1015662628 6:135592272-135592294 ATACCTAATAATTGGATTGCTGG + Intergenic
1017948120 6:159113144-159113166 ACAGCTAACAAGCGGAGAGCTGG + Intergenic
1021143695 7:17059030-17059052 ACATTTAATAACTGGGTATCAGG - Intergenic
1021223792 7:18004881-18004903 ACATCTAAACAGTGGAGTGCTGG - Intergenic
1021793117 7:24226206-24226228 ATATCCAATAATTGGATTGCTGG + Intergenic
1022692765 7:32673505-32673527 AAATCTAGTATGTGGAAAGCAGG - Intergenic
1022920442 7:35008039-35008061 AAATCTAGTATGTGGAAAGCAGG - Intronic
1028265291 7:88716484-88716506 ACATTCACTAAGTGGAGAGCTGG - Intergenic
1029046392 7:97633815-97633837 ACATCAAATAAGTGCTTATCAGG + Intergenic
1030060488 7:105617498-105617520 ACTACTCACAAGTGGATAGCAGG + Intronic
1030937184 7:115599197-115599219 ATATCCAATAATGGGATAGCTGG - Intergenic
1031104535 7:117525078-117525100 ACATGTAATATTTGGATAGGAGG + Intronic
1031827124 7:126579513-126579535 ACATTTAATAAGTCCATGGCAGG + Intronic
1032088171 7:128894364-128894386 ACATCTAATAAGTGGATAGCTGG - Intronic
1039609465 8:38907801-38907823 ACATAAAATAAGTGGCTGGCTGG - Intronic
1040271138 8:45945135-45945157 ACATATAAAAAGTAGACAGCAGG + Intergenic
1041330134 8:56715364-56715386 ACAGCTATTAAGTGGTGAGCGGG - Intergenic
1041897979 8:62948085-62948107 ACAACTAGTAAGTGTAGAGCTGG + Intronic
1041927264 8:63249846-63249868 ACAGCTAATAAATTGATAACTGG - Intergenic
1042780664 8:72487449-72487471 ACATCCAATAATTCGATTGCTGG - Intergenic
1043522582 8:81062517-81062539 ATATCTGATAATGGGATAGCTGG - Intronic
1044384621 8:91572885-91572907 ACACCTAGTAAGGGAATAGCTGG - Intergenic
1045961654 8:107975915-107975937 TCTTCTAATAAGTGGATAGTAGG + Intronic
1048982472 8:139710194-139710216 AAATCTGATTAGTGGATATCAGG + Intergenic
1060800320 9:126540479-126540501 ACAGCTACTAAGTGACTAGCGGG + Intergenic
1203418411 Un_KI270378v1:518-540 ACATATAAAAAGTAGACAGCAGG + Intergenic
1187110220 X:16290798-16290820 ACACCTAATATGTAGATAGTGGG - Intergenic
1187644357 X:21330422-21330444 ACATCTAATAACAGGATGACAGG + Intergenic
1188967275 X:36569940-36569962 ACGTCTACTAAGTGGGTAACAGG + Intergenic
1192867339 X:75148650-75148672 ACTTCTAAGAAGAGGATATCAGG + Intronic
1193102634 X:77632895-77632917 TCACCTAATATTTGGATAGCTGG + Intronic
1193117616 X:77790629-77790651 ACATCAAAACACTGGATAGCTGG + Intergenic
1193609597 X:83613271-83613293 ACATCCAATAATGGGATTGCTGG + Intergenic
1197149437 X:123203996-123204018 ACATCTATTTAGTGGAGAACAGG - Intronic
1201349081 Y:13019505-13019527 ACACCTAATAATGGGATGGCTGG + Intergenic