ID: 1032089780

View in Genome Browser
Species Human (GRCh38)
Location 7:128905680-128905702
Sequence TTTTTTCTATGGGCAGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 2, 1: 1, 2: 4, 3: 35, 4: 387}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032089780_1032089787 -8 Left 1032089780 7:128905680-128905702 CCCCCCACTGCCCATAGAAAAAA 0: 2
1: 1
2: 4
3: 35
4: 387
Right 1032089787 7:128905695-128905717 AGAAAAAAGTCCTAATTGCAAGG No data
1032089780_1032089789 16 Left 1032089780 7:128905680-128905702 CCCCCCACTGCCCATAGAAAAAA 0: 2
1: 1
2: 4
3: 35
4: 387
Right 1032089789 7:128905719-128905741 TTACAGCAGCCTGTTCCCACTGG No data
1032089780_1032089791 29 Left 1032089780 7:128905680-128905702 CCCCCCACTGCCCATAGAAAAAA 0: 2
1: 1
2: 4
3: 35
4: 387
Right 1032089791 7:128905732-128905754 TTCCCACTGGCCTTCCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032089780 Original CRISPR TTTTTTCTATGGGCAGTGGG GGG (reversed) Intronic