ID: 1032089964

View in Genome Browser
Species Human (GRCh38)
Location 7:128906589-128906611
Sequence CCAGCACATTCCCCAGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 0, 3: 58, 4: 270}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032089956_1032089964 3 Left 1032089956 7:128906563-128906585 CCCTAGGAAACCATCTCTTCCAG 0: 1
1: 0
2: 2
3: 34
4: 376
Right 1032089964 7:128906589-128906611 CCAGCACATTCCCCAGAGAGGGG 0: 1
1: 0
2: 0
3: 58
4: 270
1032089957_1032089964 2 Left 1032089957 7:128906564-128906586 CCTAGGAAACCATCTCTTCCAGG 0: 1
1: 0
2: 2
3: 26
4: 295
Right 1032089964 7:128906589-128906611 CCAGCACATTCCCCAGAGAGGGG 0: 1
1: 0
2: 0
3: 58
4: 270
1032089955_1032089964 17 Left 1032089955 7:128906549-128906571 CCTGATGCTCTTAACCCTAGGAA 0: 1
1: 0
2: 1
3: 8
4: 74
Right 1032089964 7:128906589-128906611 CCAGCACATTCCCCAGAGAGGGG 0: 1
1: 0
2: 0
3: 58
4: 270
1032089952_1032089964 27 Left 1032089952 7:128906539-128906561 CCCATCGTCTCCTGATGCTCTTA 0: 1
1: 0
2: 2
3: 3
4: 82
Right 1032089964 7:128906589-128906611 CCAGCACATTCCCCAGAGAGGGG 0: 1
1: 0
2: 0
3: 58
4: 270
1032089959_1032089964 -7 Left 1032089959 7:128906573-128906595 CCATCTCTTCCAGGTGCCAGCAC 0: 1
1: 0
2: 2
3: 37
4: 294
Right 1032089964 7:128906589-128906611 CCAGCACATTCCCCAGAGAGGGG 0: 1
1: 0
2: 0
3: 58
4: 270
1032089953_1032089964 26 Left 1032089953 7:128906540-128906562 CCATCGTCTCCTGATGCTCTTAA 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1032089964 7:128906589-128906611 CCAGCACATTCCCCAGAGAGGGG 0: 1
1: 0
2: 0
3: 58
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032089964 Original CRISPR CCAGCACATTCCCCAGAGAG GGG Intronic
901150854 1:7100231-7100253 CCAACACATTCCGGAGAGACGGG - Intronic
902470674 1:16646021-16646043 CCATCACATTACCCAGCCAGGGG - Intergenic
902488129 1:16761439-16761461 CCATCACATTACCCAGCCAGGGG + Intronic
902876361 1:19343111-19343133 CCTGCACAGTCCCCAGGCAGTGG - Intronic
903539636 1:24089757-24089779 CCTACCCATCCCCCAGAGAGGGG + Intronic
903786136 1:25862569-25862591 CCAGCTCCTTGCCCAGGGAGAGG - Exonic
904334455 1:29787702-29787724 CCAGCTCATTAACCAGACAGGGG - Intergenic
905027286 1:34859543-34859565 CCAGAACACCCGCCAGAGAGGGG + Intronic
905150089 1:35920426-35920448 CCACCCCATTCCCCAAAGAAAGG - Exonic
905208795 1:36359041-36359063 CAAACACATTTCCCAAAGAGAGG + Intronic
906052633 1:42887645-42887667 CCAGCGCAGTCCCCAGACACAGG + Intergenic
907046558 1:51303358-51303380 CCAGCACATTCCTGGGAGAAGGG + Intronic
908765794 1:67553716-67553738 CCAGTTCATCCCCCAGAAAGTGG - Intergenic
911205431 1:95087346-95087368 CCAGCTCAGTCCCCTGAGAGTGG + Intergenic
913113987 1:115680102-115680124 CCATGGCATTCTCCAGAGAGGGG - Intronic
913302005 1:117381346-117381368 CCACAACAGTCCCCAGAGTGTGG + Intronic
914490650 1:148148530-148148552 CCAGCACCTTCCCTTGGGAGTGG - Intronic
914688244 1:150001768-150001790 TCAGCATCTTCCCCAGAGAAGGG - Intronic
915152404 1:153844742-153844764 CCACCACAGTCCCCAGAGTGTGG - Intronic
915333558 1:155127994-155128016 GCAGCACAGACCCAAGAGAGGGG - Exonic
916483033 1:165232674-165232696 CCAGCACATTCCCCAAGAATTGG - Intronic
917568980 1:176244217-176244239 CCAGAACATTCTCCAGAAAAAGG - Intergenic
917822367 1:178777112-178777134 CCACCACAATCCCCAGAGTGTGG + Intronic
918865943 1:189900141-189900163 TTAGCACCTTCACCAGAGAGTGG + Intergenic
919987487 1:202685995-202686017 CAAGCACATCCACCAGAGAGAGG + Intronic
920493211 1:206435085-206435107 CCAGAATATTCCTCACAGAGTGG - Intronic
921389884 1:214606686-214606708 CCAGCACCTTCCCTTGGGAGTGG + Intronic
1064344545 10:14519939-14519961 GCAGCACGCTCCTCAGAGAGGGG - Exonic
1064841282 10:19595265-19595287 CCATCACATTTCCCTGAGAGAGG - Exonic
1065139916 10:22710325-22710347 AAAGAACAGTCCCCAGAGAGGGG - Intronic
1066448296 10:35504340-35504362 CCAGGACATTCTCCAGGGAATGG + Intronic
1067511102 10:46895715-46895737 CCAGAAGAGTCCCCAGAGAGTGG + Intergenic
1067651151 10:48156147-48156169 CCAGAAGAGTCCCCAGAGAGTGG - Intergenic
1067839941 10:49667498-49667520 CCAGCCTCTTCCTCAGAGAGAGG - Intergenic
1069261612 10:66404916-66404938 GCAGAACATTCCAAAGAGAGGGG + Intronic
1069751378 10:70747444-70747466 CCAGCACATTCCCCACAGCCAGG - Intronic
1071047449 10:81399345-81399367 CCAGCACATACTCCAGAGGAAGG + Intergenic
1072488793 10:95882670-95882692 CCACAACAGTCCCCAGAGTGTGG - Intronic
1073287252 10:102396391-102396413 CCAGCCCCTCCCCCAGAGAGAGG - Intronic
1073544151 10:104335080-104335102 CCAGCAGATTGCTCAGAGGGTGG - Intronic
1074383771 10:113001112-113001134 CCAGCACATTCCCCAGCCAAGGG - Intronic
1074630635 10:115251258-115251280 CTATCACATTCCAGAGAGAGTGG - Intronic
1075374373 10:121966239-121966261 CCAGCAACTTCTCCAGACAGAGG - Intronic
1076849802 10:133087223-133087245 CCAGCACGTGCCCCAGAAAACGG + Intronic
1077060108 11:614176-614198 CCAGCACAGGCCCCAGTCAGGGG + Exonic
1077101525 11:824625-824647 CCAGCGCGTCCCCCAGCGAGAGG - Exonic
1077390365 11:2298223-2298245 CCTGCACCTGTCCCAGAGAGAGG + Intronic
1079335823 11:19569722-19569744 GCAGCTCATTCCCCAGAGAAGGG - Intronic
1079428294 11:20364099-20364121 TCAGCACTTTCCCCAGAGCCCGG + Intronic
1081468370 11:43346259-43346281 CCACCACAGTCCCCAGAGTGTGG + Intergenic
1082122530 11:48394573-48394595 CCACCACAGTCCCCAGAGCGTGG - Intergenic
1083421559 11:62556189-62556211 CCAGCACATGGCACAGAGACTGG - Intronic
1083619614 11:64042397-64042419 CCCCCCCATTCCCCAGAGAGGGG - Intronic
1084315264 11:68342167-68342189 CCAGCACTTTCCGAGGAGAGAGG - Intronic
1084459174 11:69286764-69286786 CCAGCAAACTCCCCAGGGAAAGG - Intergenic
1084773256 11:71357784-71357806 CCAGCACAGGCTGCAGAGAGTGG - Intergenic
1085235649 11:75013238-75013260 CCAGCCCCCTCACCAGAGAGTGG + Intronic
1085785167 11:79441785-79441807 CAAGCACATTTCCAAGAGAAGGG + Intergenic
1086574981 11:88329536-88329558 CCACCAAATTGCCCAGAGACAGG - Intronic
1087354249 11:97074222-97074244 TCAGCACATTCCCTAGGAAGGGG - Intergenic
1089326378 11:117660272-117660294 CCAGCACCTTCCCAAAAGGGAGG - Intronic
1090479469 11:127055459-127055481 CCAGCACATCTCCCACAAAGGGG - Intergenic
1091868988 12:3871751-3871773 CCAACACAACCCTCAGAGAGTGG - Intronic
1094636521 12:32231750-32231772 CCACAACAGTCCCCAGAGTGGGG + Intronic
1094864116 12:34508715-34508737 CCACAACAGTCCCCAGAGTGTGG - Intergenic
1095401945 12:41824181-41824203 CCACAACAGTCCCCAGAGTGTGG - Intergenic
1095553905 12:43476825-43476847 CCACCACAGTCCCCAGAGTGTGG - Intronic
1099842508 12:87983551-87983573 CCACAACAGTCCCCAGAGTGTGG + Intronic
1100235090 12:92652866-92652888 CCAGCCCCTTCCCCAATGAGAGG + Intergenic
1102519830 12:113471435-113471457 CCAGCACGTTCAGCAGAAAGCGG + Exonic
1102903668 12:116658565-116658587 CCAGCTTATTCCGCGGAGAGGGG - Intergenic
1103730913 12:123027203-123027225 CCAGCACTTTCCCCAGTGTATGG + Intronic
1104792225 12:131490804-131490826 CCAGAACATTCCCCAGCATGTGG + Intergenic
1106079538 13:26488659-26488681 TAAGCATATGCCCCAGAGAGCGG + Intergenic
1106252042 13:27989415-27989437 CCACCAGATTGCCCAGGGAGCGG - Intergenic
1107304223 13:39000976-39000998 CCACCACAGTCCCCAGAGTGTGG + Intergenic
1108595668 13:51946448-51946470 CAAGCACATCTCCCAGACAGAGG - Exonic
1109757373 13:66778112-66778134 CCACAACAGTCCCCAGAGTGTGG - Intronic
1111872085 13:93845813-93845835 CCACAACAGTCCCCAGAGTGTGG - Intronic
1116788852 14:49318240-49318262 CAAGCTCATTGCCCAGAGAGGGG + Intergenic
1118316088 14:64726962-64726984 CCAGCACAGGCCACAGACAGGGG + Intronic
1119144385 14:72297585-72297607 CCACCACAGTCCCCAGAGTGTGG + Intronic
1119729006 14:76939307-76939329 CCAGCAGATCCCTCATAGAGAGG + Intergenic
1120437488 14:84499015-84499037 CCAACACAATCTCTAGAGAGGGG + Intergenic
1122857238 14:104565792-104565814 CCCTCTCCTTCCCCAGAGAGGGG + Intronic
1123007850 14:105333014-105333036 CCAGCACACGTCCCACAGAGAGG - Intronic
1125892893 15:43279306-43279328 CCAGGACATGGACCAGAGAGAGG + Intronic
1126101173 15:45119168-45119190 CCAGGACATTCCCCTGTCAGAGG - Exonic
1128109281 15:65066752-65066774 CCAGCCCCACCCCCAGAGAGGGG - Intronic
1128792189 15:70441599-70441621 CCAGCACCTCACCGAGAGAGTGG - Intergenic
1129399906 15:75275770-75275792 CCAGCACATCCCCAAGGCAGAGG - Intronic
1129882879 15:79018734-79018756 CCAGCACAGTCCCAGGAGAATGG - Intronic
1132744738 16:1431923-1431945 CCATCACAGTCCCAAGGGAGCGG - Intergenic
1134349564 16:13424090-13424112 CCCACACAGTCCCAAGAGAGGGG + Intergenic
1136042408 16:27590726-27590748 GCAGCACATTCTCCAGGGAGAGG - Intronic
1136225571 16:28858096-28858118 CCAGCCCAACCCCCAGGGAGGGG - Intronic
1136607762 16:31348127-31348149 CAAGACCATTCCCCAGAGATTGG - Intergenic
1137352541 16:47726202-47726224 GCAGCCCATTCCCCAAACAGTGG - Intergenic
1137510060 16:49091277-49091299 CCAGCTCATTCTCAAGACAGTGG - Intergenic
1138348907 16:56336034-56336056 CCACCCCAATCCCCAGAGCGAGG - Intronic
1138442808 16:57045457-57045479 CCAACACATCCTCCTGAGAGGGG + Exonic
1138932352 16:61675429-61675451 CCACCACAGTCCCCAGAGTGTGG - Intronic
1139244075 16:65423723-65423745 ACAGCACATTTACCAGACAGTGG + Intergenic
1140298955 16:73737817-73737839 TTAGCACCTCCCCCAGAGAGTGG + Intergenic
1141446185 16:84060139-84060161 CCAGCACAGGCCCCAGAGGCGGG + Intronic
1141629033 16:85276903-85276925 CCAGCACCTTCTCCAGAGCCCGG - Intergenic
1141791558 16:86239615-86239637 CCAGCACCTTCCTGAGAGAAGGG - Intergenic
1141798203 16:86288727-86288749 CAAACACAGTCCCCAGTGAGAGG - Intergenic
1142271980 16:89094514-89094536 GCAGCCCATTCCCTGGAGAGAGG + Intronic
1142929415 17:3270148-3270170 CCAGCCCAGGCTCCAGAGAGGGG - Intergenic
1143473788 17:7191891-7191913 ACAGCACATTCTCCAGGGAGCGG + Exonic
1143540353 17:7564821-7564843 CCAGCACAGCCCCCTGCGAGAGG + Exonic
1144622112 17:16824294-16824316 CCTACAATTTCCCCAGAGAGAGG + Intergenic
1144668508 17:17118257-17118279 CCAGCACATCCTCAAAAGAGAGG - Intronic
1144735376 17:17552652-17552674 CAAGCACATTTCCATGAGAGGGG - Intronic
1144884312 17:18448419-18448441 CCTACAATTTCCCCAGAGAGAGG - Intergenic
1145147919 17:20495958-20495980 CCTACAATTTCCCCAGAGAGAGG + Intergenic
1145191234 17:20843132-20843154 CCAGCACCTTCCCTTGGGAGTGG - Intronic
1146369855 17:32258916-32258938 CCAGCACCTGCTCCAGTGAGGGG - Intergenic
1146682236 17:34816475-34816497 CCCCTACATTCACCAGAGAGAGG - Intergenic
1146923553 17:36729290-36729312 CCCGCACATTCCCCAGTGCCTGG - Intergenic
1147034837 17:37672177-37672199 CCAGCATAAGCCCCTGAGAGTGG - Intergenic
1147574081 17:41588629-41588651 CCTACAATTTCCCCAGAGAGAGG + Intergenic
1147640472 17:41995154-41995176 CCATGGCATTCCCTAGAGAGAGG + Intronic
1147640585 17:41996376-41996398 CCATGGCATTCCCCAGAGAGAGG + Exonic
1147854623 17:43469725-43469747 CCAGCTTTTTCCCCAGAGAGGGG + Intergenic
1149390374 17:56184008-56184030 ACAGCATATTCACCAAAGAGTGG - Intronic
1151112981 17:71701437-71701459 CCACAACAGTCCCCAGAGTGTGG - Intergenic
1152277189 17:79364751-79364773 CCAGCACAGCCTCCAGGGAGAGG + Intronic
1152430995 17:80248272-80248294 CCAGCACACTCCCCACTCAGAGG - Intronic
1152446251 17:80346117-80346139 CCAGCAGATTGTCCAGAGACTGG + Exonic
1156016888 18:32556444-32556466 CAAGCACCTTCTTCAGAGAGCGG - Intergenic
1156275540 18:35580883-35580905 CCCGCACAGTGCCCGGAGAGGGG - Intergenic
1156653611 18:39256567-39256589 CCACAACAGTCCCCAGAGTGTGG - Intergenic
1158040447 18:53086762-53086784 CCACAACAGTCCCCAGAGTGTGG + Intronic
1158078068 18:53554365-53554387 CCATTACATTCCCCATAGAATGG - Intergenic
1159028216 18:63206138-63206160 CGAGCACATCCCCCTGGGAGAGG - Intronic
1160088237 18:75800580-75800602 CCAGCGCATTCCAAATAGAGGGG - Intergenic
1160474279 18:79168142-79168164 CCATCACATTGACCAGAAAGTGG + Intronic
1160994968 19:1878296-1878318 CCAGCACCTTCCCTTGGGAGTGG + Intronic
1162470697 19:10870949-10870971 CCCGCCCATTCCCCAGAGCGGGG + Intergenic
1162493271 19:11007853-11007875 TCAGTTCATCCCCCAGAGAGGGG - Intronic
1162855093 19:13461962-13461984 CCTGCAGAGGCCCCAGAGAGAGG + Intronic
1164445459 19:28313908-28313930 CCCACACATTCCCCATGGAGGGG - Intergenic
1164800624 19:31073371-31073393 CCAGAACCTTCCCCAAGGAGAGG + Intergenic
1166817747 19:45557063-45557085 CTAGCACAGTGGCCAGAGAGTGG + Intronic
1168284836 19:55325849-55325871 TCAGAACCTTCCCCAGGGAGGGG + Intronic
1202703069 1_KI270713v1_random:2801-2823 CCATCACATTACCCAGCCAGGGG - Intergenic
925145266 2:1578485-1578507 CCTGCACATTCCCCGCAGAGTGG - Intergenic
925265218 2:2562190-2562212 CCAGCACATTCCCAGGTGAATGG + Intergenic
925846675 2:8040955-8040977 CCACCACAGTCCCCAGAGTGTGG + Intergenic
926699162 2:15791099-15791121 CCTTCACATTCTCCAGAAAGAGG + Intergenic
926933928 2:18067929-18067951 CCAGCGCATTTCTCAGGGAGTGG + Intronic
929529240 2:42736707-42736729 CCAGCACATTCCCAGGTGGGTGG - Intronic
932812651 2:74837285-74837307 CGCTCACATTCCCCAGAGACAGG - Intronic
932955358 2:76345314-76345336 CCAGGACAGTCCCCAGAGTGTGG + Intergenic
933550933 2:83774151-83774173 CCACCACAGTCCCCAGAGTGTGG - Intergenic
933569899 2:83997825-83997847 CCTGCACATTTACCACAGAGGGG + Intergenic
935056713 2:99573858-99573880 CCAGCACTTCCTCCAGGGAGCGG + Intronic
935671399 2:105559893-105559915 ACAGCATCCTCCCCAGAGAGGGG - Intergenic
936064853 2:109323117-109323139 CCAGCATATGCTCCAGAGAGAGG + Intronic
936517625 2:113192435-113192457 CAAGCACAGTCCCCAGAGGAAGG + Exonic
937920116 2:127122795-127122817 GCAGCACCCTCCCCAGAGAAGGG - Intergenic
938705038 2:133916321-133916343 CCACCACAGTCCCCAGAGTGTGG - Intergenic
938907927 2:135856411-135856433 CCAGCCCAGTCTCCAGTGAGAGG + Intronic
939075589 2:137599044-137599066 CCACCACAGTCCCCAGAGTGTGG + Intronic
939100383 2:137888974-137888996 TCAGCAGTTTCCCCTGAGAGTGG + Intergenic
940216753 2:151310615-151310637 CCAGCAATTTCCTCTGAGAGAGG + Intergenic
941121129 2:161531703-161531725 CCACCACAGTCCGCAGAGTGTGG - Intronic
941489500 2:166125861-166125883 ACAGCACATTTCCCAGCAAGAGG + Intronic
943810876 2:192187966-192187988 CCAGCACCTTCCACAGAGTCTGG + Intronic
943970207 2:194394677-194394699 CCACAACAGTCCCCAGAGTGTGG - Intergenic
944301934 2:198133356-198133378 CCACCACAGTCCCCAGAGTGTGG - Intronic
945969354 2:216221056-216221078 CCAGGACAGCCCCAAGAGAGTGG + Intergenic
947097684 2:226584758-226584780 CCAACACACTACCCAGACAGTGG - Intergenic
948851808 2:240711912-240711934 CCAACCCAGTCCCCAGGGAGAGG - Intergenic
1169227302 20:3864751-3864773 CCAGCACAGTCCCCACTGACGGG + Exonic
1171405071 20:24906441-24906463 CCACAACAGTCCCCAGAGTGTGG - Intergenic
1172347127 20:34210354-34210376 CCACCACATTCCCCAGTGGCAGG + Intronic
1173536711 20:43820311-43820333 CCACCACAGTCCCCAGAGTGTGG - Intergenic
1174715064 20:52748768-52748790 CCCCCACCTTCCCCAGAGTGTGG - Intergenic
1175304127 20:57964373-57964395 CCAGCACCATCCCCAAAGATGGG - Intergenic
1175562377 20:59940848-59940870 CCAGCAGATTCCCTTGAGGGTGG + Intronic
1175902527 20:62365808-62365830 CCAGCACAGTCCTCTGAGATAGG - Intronic
1176102244 20:63369868-63369890 TCAGCACATTCCTCTGAAAGTGG + Intronic
1177253361 21:18625789-18625811 CCACAACAGTCCCCAGAGTGTGG + Intergenic
1179726532 21:43344231-43344253 CCATCACCTTCCCCAGCGGGTGG - Intergenic
1180150948 21:45947526-45947548 CCGGCCCATTCCCCGGGGAGAGG + Intergenic
1181121024 22:20668830-20668852 CCAGCACCTTCCCTTGGGAGTGG + Intergenic
1181333990 22:22115856-22115878 CCAGCACCTTCCCTTGGGAGTGG + Intergenic
1182354677 22:29717275-29717297 GCAGCACCTTCCCCAGATGGGGG + Intergenic
1183214972 22:36473708-36473730 ACAGCACAGTCCCCAGGCAGTGG + Intronic
1183320780 22:37163885-37163907 CCAGCTCATTCCTCAGTGCGTGG + Intronic
1183834945 22:40444666-40444688 CCACCACATTCATCAGAGAAGGG + Intronic
1184191775 22:42899739-42899761 CCTGTGCATTCCCCAGGGAGAGG - Intronic
1185094906 22:48800845-48800867 CCAGCCCACTCCCCTGAGTGGGG - Intronic
949150405 3:760113-760135 CCACAACAGTCCCCAGAGTGTGG + Intergenic
951284461 3:20791616-20791638 CAATCACATTCCCTAGGGAGAGG + Intergenic
953228975 3:41046411-41046433 CCTCCAGTTTCCCCAGAGAGTGG + Intergenic
953390560 3:42531477-42531499 CCAGCACATTCACCATGGTGTGG + Exonic
953784000 3:45896876-45896898 TCTGTCCATTCCCCAGAGAGGGG + Intronic
954298757 3:49688233-49688255 CCATCACATTACCCAGCCAGGGG + Intronic
954415450 3:50391187-50391209 CCATCACATTCCCCAGGGCAGGG + Intronic
954602405 3:51879664-51879686 CCAGCACATCCCCCAAAGCTAGG - Intergenic
956845360 3:73177418-73177440 CCAGCTAATTACCCAGAGAGTGG - Intergenic
958506695 3:94988197-94988219 CCAGCACATTTCCCCGCAAGCGG - Intergenic
960187540 3:114662065-114662087 CCACCACAGTCCCCAGAGTGTGG + Intronic
960546461 3:118920090-118920112 CCACCACAGTCCCCAGAGTGTGG - Intronic
961294107 3:125870351-125870373 CCACCACAGTCCCCAGAGTGTGG - Intergenic
961442249 3:126960003-126960025 CCAGCACAGTCCCCAGCAACAGG - Intronic
962533210 3:136302725-136302747 CCACAACAGTCCCCAGAGTGTGG + Intronic
963299048 3:143578641-143578663 CCAGGAAATTCCCCACAGACTGG + Exonic
966798368 3:183738563-183738585 CCACCACAGTCCCCAGAGTGTGG + Intronic
968563570 4:1297392-1297414 TCAGCTCATTCCCCAGAGCACGG + Intronic
968677431 4:1891399-1891421 TCAGGACATTCCCCAGAGCCAGG - Intronic
971849573 4:31966924-31966946 CCACCACAGTCCCCAGAGTGTGG + Intergenic
972396170 4:38661620-38661642 CCAGCATAGTGGCCAGAGAGTGG + Intergenic
972638867 4:40908186-40908208 CCAGCACAAACCCGGGAGAGCGG + Intronic
974830519 4:67182880-67182902 CCACCACAGTCCCCAGAGTGTGG - Intergenic
975822456 4:78285768-78285790 CCAGTACCTTCCTCAGAGGGTGG + Intronic
975964564 4:79955556-79955578 CCTGCACATTGCCCTCAGAGAGG - Intronic
976049477 4:80994636-80994658 CCACAACAGTCCCCAGAGTGTGG + Intergenic
977919720 4:102629607-102629629 AAAGCACATTCCAGAGAGAGTGG - Intergenic
978930976 4:114311873-114311895 CCAGCCCATCCGCCAGTGAGTGG - Intergenic
979106989 4:116701576-116701598 CCCTCACATTACCCAGAAAGAGG + Intergenic
979422002 4:120515867-120515889 GCAGAAGATTCCCCACAGAGTGG - Intergenic
979555945 4:122047715-122047737 CAAGCATAAGCCCCAGAGAGTGG - Intergenic
980795278 4:137674580-137674602 CCACAACAGTCCCCAGAGTGTGG + Intergenic
980908632 4:138973857-138973879 CCAGCACTTACCCGAGAAAGAGG - Intergenic
981298114 4:143156259-143156281 CCAGCACAGTCACAAGAGGGTGG - Intergenic
983389395 4:167110019-167110041 CAAGCAAATACCCTAGAGAGAGG - Intronic
983602345 4:169545214-169545236 CCACCACAGTCCCCAGAGTGTGG + Intronic
986175651 5:5349824-5349846 CCAGCACATCCACGAGGGAGAGG + Intergenic
987698856 5:21368350-21368372 CCACCACAGTCCCCAGAGTGTGG - Intergenic
990081754 5:51925128-51925150 CCAGCACAGTTTCCATAGAGTGG + Intergenic
990798980 5:59577973-59577995 CCAGTACATTTCTCAGAGACTGG + Intronic
991040215 5:62167562-62167584 ACTGAACATTCCCTAGAGAGAGG + Intergenic
991885604 5:71264073-71264095 CCACAACAGTCCCCAGAGTGTGG + Intergenic
992886151 5:81162309-81162331 CCAGCACATTCCACATTTAGAGG - Intronic
993040434 5:82808702-82808724 CCAGCAAATTCTTCACAGAGGGG + Intergenic
996807846 5:127477771-127477793 CCACCACAGTCCCCAGAGTGTGG - Intergenic
997596657 5:135111659-135111681 CCAGCACATTGCCAGGAGGGTGG - Intronic
1000044628 5:157511945-157511967 CCATCACATACCCCACAGAGGGG + Intronic
1000337355 5:160251691-160251713 CCAGCACGACCCCCAGAAAGAGG - Exonic
1001770669 5:174293549-174293571 GCAGCCCATTCCCAACAGAGTGG - Intergenic
1001829521 5:174773914-174773936 CAAGCCCATTCCCAAGAGAGAGG - Intergenic
1002256105 5:177959465-177959487 CCCTCAAATTCCCCAGGGAGGGG - Intergenic
1004187155 6:13430713-13430735 CCAGCACAGCCTCCAGACAGTGG + Intronic
1004936020 6:20509167-20509189 CCAGTACCCTCCCCAGAGATTGG + Intergenic
1005190674 6:23218896-23218918 CCATCAGATTACCCACAGAGGGG + Intergenic
1005668987 6:28085808-28085830 CATGAACATTACCCAGAGAGTGG + Exonic
1005905276 6:30257567-30257589 CTACCACATTGCCCAGATAGAGG - Intergenic
1006787175 6:36676314-36676336 CCAGCCCCCTCCCCAGAGTGCGG - Intergenic
1007363072 6:41372489-41372511 CCCGCACCTTCCCCAGAGCTTGG + Intergenic
1007665074 6:43509121-43509143 CCAGGACATTGCACAGGGAGGGG + Intronic
1008274459 6:49526776-49526798 CCAGGACGTTCCCCTGAGAGGGG - Exonic
1009854532 6:69244832-69244854 TCAGCACTTAACCCAGAGAGTGG + Intronic
1010180356 6:73079474-73079496 CCAGAACATTTGTCAGAGAGGGG + Intronic
1010350645 6:74870238-74870260 CCAGTACATTTCTCAGAAAGAGG + Intergenic
1016584466 6:145667994-145668016 CCACCACAGTCCCCAGAGTGTGG - Intronic
1018553329 6:165024155-165024177 CGATCACATCCCCCACAGAGTGG - Intergenic
1018973504 6:168545731-168545753 CCAGCCCATTCCCCAGTCACTGG - Intronic
1019779338 7:2930290-2930312 CCAGCAGATGCCACAGAGAGTGG - Intronic
1020009097 7:4798824-4798846 TCAGCACAGGCCCCAGAGAAAGG - Intronic
1020870360 7:13621810-13621832 CCACAACAGTCCCCAGAGTGTGG - Intergenic
1022520213 7:31001315-31001337 CCAGCAGAGTGCCCAGACAGTGG - Intergenic
1023054929 7:36283633-36283655 CCAGCACACTCTCCAGGGGGTGG + Intronic
1023450356 7:40277849-40277871 CCACAACAGTCCCCAGAGTGTGG + Intronic
1024455226 7:49598259-49598281 CCTGCACAGGCCCCAGAGAATGG - Intergenic
1027819937 7:83029941-83029963 CCACAACAGTCCCCAGAGTGTGG - Intronic
1027898212 7:84073311-84073333 CCAGTAGAATCCACAGAGAGAGG + Intronic
1028902608 7:96118226-96118248 ACAGCACATAACCCAGCGAGTGG - Intergenic
1029191600 7:98776005-98776027 ACAGCCCAGTCCCCAGGGAGTGG - Intergenic
1032089964 7:128906589-128906611 CCAGCACATTCCCCAGAGAGGGG + Intronic
1032092840 7:128920244-128920266 CCAGCAGTGTCCCCACAGAGGGG - Intergenic
1032321046 7:130887108-130887130 CCACCACTTTCCCCTGTGAGGGG + Intergenic
1033534637 7:142300463-142300485 TCTGCACATGCCCCAGGGAGAGG - Intergenic
1033960905 7:146911636-146911658 CCACCACAGTCCCCAGAGTGTGG - Intronic
1034179324 7:149125807-149125829 CCACCAGGTTCCCCAGGGAGGGG - Intronic
1034317956 7:150151716-150151738 CCACAACAGTCCCCAGAGTGTGG - Intergenic
1035278070 7:157759856-157759878 CCAGCTCCTCCCCAAGAGAGGGG - Intronic
1037808115 8:22069597-22069619 CGAGCATATACCCCAGAGAGTGG - Intronic
1038434554 8:27526101-27526123 CCTGCACACTCCAGAGAGAGAGG + Intronic
1038447098 8:27611783-27611805 TCAGCGCCTTCCCCAGAGATGGG + Intronic
1039238225 8:35526296-35526318 GCAGCACACTCTCCAGAAAGCGG + Intronic
1039913086 8:41840179-41840201 CCAGCACGTTGCCTAAAGAGGGG - Intronic
1041010817 8:53541894-53541916 CCAGCACTTACCCACGAGAGGGG + Intergenic
1042402689 8:68367729-68367751 CCACCACAGTCCCCAGAGTGTGG - Intronic
1043056683 8:75448263-75448285 CCACCACAGTCCCCAGAGTGTGG - Intronic
1044792858 8:95865510-95865532 CCAGCAGTTGCTCCAGAGAGGGG - Intergenic
1045486400 8:102634879-102634901 CCACCCCATTACCCATAGAGTGG - Intergenic
1046876236 8:119257736-119257758 CTAGCACTTTCCCCACATAGTGG - Intergenic
1047996576 8:130342421-130342443 CCAGCACATTCTACCAAGAGTGG + Intronic
1048300289 8:133246303-133246325 CCAGGACATTCCTCCAAGAGGGG - Intronic
1049206018 8:141363930-141363952 CCAGCCTTTTCCCCACAGAGGGG + Intronic
1049510570 8:143024854-143024876 CCAGCAAATTCCCCAGGGTGGGG - Intergenic
1049536531 8:143185166-143185188 CTATCACATCACCCAGAGAGAGG - Intergenic
1049877445 8:145034396-145034418 CCACAACAGTCCCCAGAGTGTGG - Intergenic
1050015582 9:1229718-1229740 CCACCACAGTCCCCAGAGTGTGG - Intergenic
1050803286 9:9642245-9642267 CCACCACAGTCCCCAGAGTGTGG - Intronic
1051333788 9:16048337-16048359 CCAGCTCCCTCCTCAGAGAGAGG - Intronic
1053918486 9:42964203-42964225 CCAGCAAATGTCCCAGAGATGGG + Intergenic
1055664067 9:78535752-78535774 CCACCACAGTCCCCACAGTGTGG - Intergenic
1055728575 9:79257771-79257793 CCAGCAGATTCCCCACAGCTCGG + Intergenic
1056819125 9:89824623-89824645 CCAGAACGTACCCCAGAGACTGG + Intergenic
1057539948 9:95958038-95958060 CCACAACAGTCCCCAGAGTGTGG + Intronic
1058807154 9:108603820-108603842 CCAGAACATTTGCCAGTGAGAGG - Intergenic
1059327820 9:113514910-113514932 CCTGCCCTTTCCCCAGAGAAAGG - Intronic
1060657264 9:125380633-125380655 CCAGGAAATTCCCCAGAGCGGGG + Intergenic
1061078379 9:128355387-128355409 CCAGCACATCACCTAGGGAGGGG - Exonic
1061372699 9:130206770-130206792 CCTGCATTTTCCCAAGAGAGAGG - Intronic
1062095872 9:134703058-134703080 CCATCTCATTCCACAGAGCGTGG - Intronic
1062096586 9:134706926-134706948 CCAGCACCTTCCCCAGCCTGTGG + Intronic
1188253402 X:27928196-27928218 CCACCACAGTCCCCAGAGTGTGG - Intergenic
1188659166 X:32736746-32736768 CCACCACAGTCCCCAGAGTGTGG - Intronic
1189102646 X:38207292-38207314 CCTGCCCATTGCCCAGAGATGGG + Intronic
1190414161 X:50165334-50165356 TTAGGACATTCCCTAGAGAGAGG - Intergenic
1190932226 X:54958789-54958811 CCAGCACAAACCCCAAAGAAAGG - Intronic
1192506726 X:71690216-71690238 TCAGCCCAGTCACCAGAGAGAGG + Intergenic
1192519971 X:71791330-71791352 TCAGCCCAGTCACCAGAGAGAGG - Intergenic
1192696290 X:73419410-73419432 CCACAACAGTCCCCAGAGTGTGG + Intergenic
1194945715 X:100064587-100064609 CCAGGACCTTCTCCAGAGACTGG + Intergenic
1200072228 X:153534960-153534982 CCAGGAGCTTCCCCAGAGACGGG + Intronic
1200180914 X:154150238-154150260 CCAGAAGATTCCCCAGCTAGTGG - Intronic
1200186557 X:154187352-154187374 CCAGAAGATTCCCCAGCTAGTGG - Intergenic
1200192209 X:154224490-154224512 CCAGAAGATTCCCCAGCTAGTGG - Intronic
1200197964 X:154262294-154262316 CCAGAAGATTCCCCAGCTAGTGG - Intronic
1201192088 Y:11453101-11453123 CCAGCATGGTCCCCAGAGCGTGG - Intergenic
1201936165 Y:19412821-19412843 CCACAACAGTCCCCAGAGTGTGG + Intergenic