ID: 1032090943

View in Genome Browser
Species Human (GRCh38)
Location 7:128911345-128911367
Sequence AGGGGTGTTGAGTGGAGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032090943_1032090957 18 Left 1032090943 7:128911345-128911367 CCTGAACTCCACTCAACACCCCT No data
Right 1032090957 7:128911386-128911408 AGGCTTGGCCCCAAATGCCAAGG No data
1032090943_1032090951 3 Left 1032090943 7:128911345-128911367 CCTGAACTCCACTCAACACCCCT No data
Right 1032090951 7:128911371-128911393 CACCCCAGCAGTCCCAGGCTTGG No data
1032090943_1032090948 -2 Left 1032090943 7:128911345-128911367 CCTGAACTCCACTCAACACCCCT No data
Right 1032090948 7:128911366-128911388 CTACCCACCCCAGCAGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032090943 Original CRISPR AGGGGTGTTGAGTGGAGTTC AGG (reversed) Intergenic
No off target data available for this crispr