ID: 1032091686

View in Genome Browser
Species Human (GRCh38)
Location 7:128914633-128914655
Sequence CCCTCACTCCAGGAGCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032091681_1032091686 -9 Left 1032091681 7:128914619-128914641 CCCAGGCGACAGTCCCCTCACTC No data
Right 1032091686 7:128914633-128914655 CCCTCACTCCAGGAGCTGCAAGG No data
1032091674_1032091686 11 Left 1032091674 7:128914599-128914621 CCCCAGGGCCCCAGTGGAGTCCC No data
Right 1032091686 7:128914633-128914655 CCCTCACTCCAGGAGCTGCAAGG No data
1032091679_1032091686 2 Left 1032091679 7:128914608-128914630 CCCAGTGGAGTCCCAGGCGACAG No data
Right 1032091686 7:128914633-128914655 CCCTCACTCCAGGAGCTGCAAGG No data
1032091676_1032091686 9 Left 1032091676 7:128914601-128914623 CCAGGGCCCCAGTGGAGTCCCAG No data
Right 1032091686 7:128914633-128914655 CCCTCACTCCAGGAGCTGCAAGG No data
1032091680_1032091686 1 Left 1032091680 7:128914609-128914631 CCAGTGGAGTCCCAGGCGACAGT No data
Right 1032091686 7:128914633-128914655 CCCTCACTCCAGGAGCTGCAAGG No data
1032091678_1032091686 3 Left 1032091678 7:128914607-128914629 CCCCAGTGGAGTCCCAGGCGACA No data
Right 1032091686 7:128914633-128914655 CCCTCACTCCAGGAGCTGCAAGG No data
1032091682_1032091686 -10 Left 1032091682 7:128914620-128914642 CCAGGCGACAGTCCCCTCACTCC No data
Right 1032091686 7:128914633-128914655 CCCTCACTCCAGGAGCTGCAAGG No data
1032091675_1032091686 10 Left 1032091675 7:128914600-128914622 CCCAGGGCCCCAGTGGAGTCCCA No data
Right 1032091686 7:128914633-128914655 CCCTCACTCCAGGAGCTGCAAGG No data
1032091673_1032091686 15 Left 1032091673 7:128914595-128914617 CCAACCCCAGGGCCCCAGTGGAG No data
Right 1032091686 7:128914633-128914655 CCCTCACTCCAGGAGCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032091686 Original CRISPR CCCTCACTCCAGGAGCTGCA AGG Intergenic
No off target data available for this crispr