ID: 1032095238

View in Genome Browser
Species Human (GRCh38)
Location 7:128935005-128935027
Sequence TGGGGTGGGGAGCAGGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032095238_1032095256 30 Left 1032095238 7:128935005-128935027 CCTCCCCCCTGCTCCCCACCCCA No data
Right 1032095256 7:128935058-128935080 GTAGCTTCTACTCGAGTCAGGGG No data
1032095238_1032095255 29 Left 1032095238 7:128935005-128935027 CCTCCCCCCTGCTCCCCACCCCA No data
Right 1032095255 7:128935057-128935079 CGTAGCTTCTACTCGAGTCAGGG No data
1032095238_1032095254 28 Left 1032095238 7:128935005-128935027 CCTCCCCCCTGCTCCCCACCCCA No data
Right 1032095254 7:128935056-128935078 GCGTAGCTTCTACTCGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032095238 Original CRISPR TGGGGTGGGGAGCAGGGGGG AGG (reversed) Intergenic
No off target data available for this crispr