ID: 1032095239

View in Genome Browser
Species Human (GRCh38)
Location 7:128935008-128935030
Sequence GGCTGGGGTGGGGAGCAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032095239_1032095254 25 Left 1032095239 7:128935008-128935030 CCCCCCTGCTCCCCACCCCAGCC No data
Right 1032095254 7:128935056-128935078 GCGTAGCTTCTACTCGAGTCAGG No data
1032095239_1032095256 27 Left 1032095239 7:128935008-128935030 CCCCCCTGCTCCCCACCCCAGCC No data
Right 1032095256 7:128935058-128935080 GTAGCTTCTACTCGAGTCAGGGG No data
1032095239_1032095255 26 Left 1032095239 7:128935008-128935030 CCCCCCTGCTCCCCACCCCAGCC No data
Right 1032095255 7:128935057-128935079 CGTAGCTTCTACTCGAGTCAGGG No data
1032095239_1032095257 30 Left 1032095239 7:128935008-128935030 CCCCCCTGCTCCCCACCCCAGCC No data
Right 1032095257 7:128935061-128935083 GCTTCTACTCGAGTCAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032095239 Original CRISPR GGCTGGGGTGGGGAGCAGGG GGG (reversed) Intergenic
No off target data available for this crispr