ID: 1032095241

View in Genome Browser
Species Human (GRCh38)
Location 7:128935010-128935032
Sequence GTGGCTGGGGTGGGGAGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032095241_1032095258 29 Left 1032095241 7:128935010-128935032 CCCCTGCTCCCCACCCCAGCCAC No data
Right 1032095258 7:128935062-128935084 CTTCTACTCGAGTCAGGGGAGGG No data
1032095241_1032095254 23 Left 1032095241 7:128935010-128935032 CCCCTGCTCCCCACCCCAGCCAC No data
Right 1032095254 7:128935056-128935078 GCGTAGCTTCTACTCGAGTCAGG No data
1032095241_1032095257 28 Left 1032095241 7:128935010-128935032 CCCCTGCTCCCCACCCCAGCCAC No data
Right 1032095257 7:128935061-128935083 GCTTCTACTCGAGTCAGGGGAGG No data
1032095241_1032095256 25 Left 1032095241 7:128935010-128935032 CCCCTGCTCCCCACCCCAGCCAC No data
Right 1032095256 7:128935058-128935080 GTAGCTTCTACTCGAGTCAGGGG No data
1032095241_1032095255 24 Left 1032095241 7:128935010-128935032 CCCCTGCTCCCCACCCCAGCCAC No data
Right 1032095255 7:128935057-128935079 CGTAGCTTCTACTCGAGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032095241 Original CRISPR GTGGCTGGGGTGGGGAGCAG GGG (reversed) Intergenic