ID: 1032095243

View in Genome Browser
Species Human (GRCh38)
Location 7:128935012-128935034
Sequence GGGTGGCTGGGGTGGGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032095243_1032095256 23 Left 1032095243 7:128935012-128935034 CCTGCTCCCCACCCCAGCCACCC No data
Right 1032095256 7:128935058-128935080 GTAGCTTCTACTCGAGTCAGGGG No data
1032095243_1032095255 22 Left 1032095243 7:128935012-128935034 CCTGCTCCCCACCCCAGCCACCC No data
Right 1032095255 7:128935057-128935079 CGTAGCTTCTACTCGAGTCAGGG No data
1032095243_1032095257 26 Left 1032095243 7:128935012-128935034 CCTGCTCCCCACCCCAGCCACCC No data
Right 1032095257 7:128935061-128935083 GCTTCTACTCGAGTCAGGGGAGG No data
1032095243_1032095254 21 Left 1032095243 7:128935012-128935034 CCTGCTCCCCACCCCAGCCACCC No data
Right 1032095254 7:128935056-128935078 GCGTAGCTTCTACTCGAGTCAGG No data
1032095243_1032095258 27 Left 1032095243 7:128935012-128935034 CCTGCTCCCCACCCCAGCCACCC No data
Right 1032095258 7:128935062-128935084 CTTCTACTCGAGTCAGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032095243 Original CRISPR GGGTGGCTGGGGTGGGGAGC AGG (reversed) Intergenic
No off target data available for this crispr