ID: 1032095247

View in Genome Browser
Species Human (GRCh38)
Location 7:128935023-128935045
Sequence AGTGTAGAGTGGGGTGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032095247_1032095255 11 Left 1032095247 7:128935023-128935045 CCCCAGCCACCCCACTCTACACT No data
Right 1032095255 7:128935057-128935079 CGTAGCTTCTACTCGAGTCAGGG No data
1032095247_1032095257 15 Left 1032095247 7:128935023-128935045 CCCCAGCCACCCCACTCTACACT No data
Right 1032095257 7:128935061-128935083 GCTTCTACTCGAGTCAGGGGAGG No data
1032095247_1032095256 12 Left 1032095247 7:128935023-128935045 CCCCAGCCACCCCACTCTACACT No data
Right 1032095256 7:128935058-128935080 GTAGCTTCTACTCGAGTCAGGGG No data
1032095247_1032095258 16 Left 1032095247 7:128935023-128935045 CCCCAGCCACCCCACTCTACACT No data
Right 1032095258 7:128935062-128935084 CTTCTACTCGAGTCAGGGGAGGG No data
1032095247_1032095254 10 Left 1032095247 7:128935023-128935045 CCCCAGCCACCCCACTCTACACT No data
Right 1032095254 7:128935056-128935078 GCGTAGCTTCTACTCGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032095247 Original CRISPR AGTGTAGAGTGGGGTGGCTG GGG (reversed) Intergenic
No off target data available for this crispr