ID: 1032095250

View in Genome Browser
Species Human (GRCh38)
Location 7:128935029-128935051
Sequence TGAGCGAGTGTAGAGTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032095250_1032095256 6 Left 1032095250 7:128935029-128935051 CCACCCCACTCTACACTCGCTCA No data
Right 1032095256 7:128935058-128935080 GTAGCTTCTACTCGAGTCAGGGG No data
1032095250_1032095254 4 Left 1032095250 7:128935029-128935051 CCACCCCACTCTACACTCGCTCA No data
Right 1032095254 7:128935056-128935078 GCGTAGCTTCTACTCGAGTCAGG No data
1032095250_1032095258 10 Left 1032095250 7:128935029-128935051 CCACCCCACTCTACACTCGCTCA No data
Right 1032095258 7:128935062-128935084 CTTCTACTCGAGTCAGGGGAGGG No data
1032095250_1032095257 9 Left 1032095250 7:128935029-128935051 CCACCCCACTCTACACTCGCTCA No data
Right 1032095257 7:128935061-128935083 GCTTCTACTCGAGTCAGGGGAGG No data
1032095250_1032095255 5 Left 1032095250 7:128935029-128935051 CCACCCCACTCTACACTCGCTCA No data
Right 1032095255 7:128935057-128935079 CGTAGCTTCTACTCGAGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032095250 Original CRISPR TGAGCGAGTGTAGAGTGGGG TGG (reversed) Intergenic