ID: 1032095252

View in Genome Browser
Species Human (GRCh38)
Location 7:128935033-128935055
Sequence TGTGTGAGCGAGTGTAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032095252_1032095258 6 Left 1032095252 7:128935033-128935055 CCCACTCTACACTCGCTCACACA No data
Right 1032095258 7:128935062-128935084 CTTCTACTCGAGTCAGGGGAGGG No data
1032095252_1032095255 1 Left 1032095252 7:128935033-128935055 CCCACTCTACACTCGCTCACACA No data
Right 1032095255 7:128935057-128935079 CGTAGCTTCTACTCGAGTCAGGG No data
1032095252_1032095257 5 Left 1032095252 7:128935033-128935055 CCCACTCTACACTCGCTCACACA No data
Right 1032095257 7:128935061-128935083 GCTTCTACTCGAGTCAGGGGAGG No data
1032095252_1032095256 2 Left 1032095252 7:128935033-128935055 CCCACTCTACACTCGCTCACACA No data
Right 1032095256 7:128935058-128935080 GTAGCTTCTACTCGAGTCAGGGG No data
1032095252_1032095254 0 Left 1032095252 7:128935033-128935055 CCCACTCTACACTCGCTCACACA No data
Right 1032095254 7:128935056-128935078 GCGTAGCTTCTACTCGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032095252 Original CRISPR TGTGTGAGCGAGTGTAGAGT GGG (reversed) Intergenic