ID: 1032095256

View in Genome Browser
Species Human (GRCh38)
Location 7:128935058-128935080
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032095242_1032095256 24 Left 1032095242 7:128935011-128935033 CCCTGCTCCCCACCCCAGCCACC No data
Right 1032095256 7:128935058-128935080 GTAGCTTCTACTCGAGTCAGGGG No data
1032095238_1032095256 30 Left 1032095238 7:128935005-128935027 CCTCCCCCCTGCTCCCCACCCCA No data
Right 1032095256 7:128935058-128935080 GTAGCTTCTACTCGAGTCAGGGG No data
1032095240_1032095256 26 Left 1032095240 7:128935009-128935031 CCCCCTGCTCCCCACCCCAGCCA No data
Right 1032095256 7:128935058-128935080 GTAGCTTCTACTCGAGTCAGGGG No data
1032095239_1032095256 27 Left 1032095239 7:128935008-128935030 CCCCCCTGCTCCCCACCCCAGCC No data
Right 1032095256 7:128935058-128935080 GTAGCTTCTACTCGAGTCAGGGG No data
1032095248_1032095256 11 Left 1032095248 7:128935024-128935046 CCCAGCCACCCCACTCTACACTC No data
Right 1032095256 7:128935058-128935080 GTAGCTTCTACTCGAGTCAGGGG No data
1032095246_1032095256 15 Left 1032095246 7:128935020-128935042 CCACCCCAGCCACCCCACTCTAC No data
Right 1032095256 7:128935058-128935080 GTAGCTTCTACTCGAGTCAGGGG No data
1032095243_1032095256 23 Left 1032095243 7:128935012-128935034 CCTGCTCCCCACCCCAGCCACCC No data
Right 1032095256 7:128935058-128935080 GTAGCTTCTACTCGAGTCAGGGG No data
1032095253_1032095256 1 Left 1032095253 7:128935034-128935056 CCACTCTACACTCGCTCACACAG No data
Right 1032095256 7:128935058-128935080 GTAGCTTCTACTCGAGTCAGGGG No data
1032095249_1032095256 10 Left 1032095249 7:128935025-128935047 CCAGCCACCCCACTCTACACTCG No data
Right 1032095256 7:128935058-128935080 GTAGCTTCTACTCGAGTCAGGGG No data
1032095244_1032095256 17 Left 1032095244 7:128935018-128935040 CCCCACCCCAGCCACCCCACTCT No data
Right 1032095256 7:128935058-128935080 GTAGCTTCTACTCGAGTCAGGGG No data
1032095252_1032095256 2 Left 1032095252 7:128935033-128935055 CCCACTCTACACTCGCTCACACA No data
Right 1032095256 7:128935058-128935080 GTAGCTTCTACTCGAGTCAGGGG No data
1032095250_1032095256 6 Left 1032095250 7:128935029-128935051 CCACCCCACTCTACACTCGCTCA No data
Right 1032095256 7:128935058-128935080 GTAGCTTCTACTCGAGTCAGGGG No data
1032095251_1032095256 3 Left 1032095251 7:128935032-128935054 CCCCACTCTACACTCGCTCACAC No data
Right 1032095256 7:128935058-128935080 GTAGCTTCTACTCGAGTCAGGGG No data
1032095241_1032095256 25 Left 1032095241 7:128935010-128935032 CCCCTGCTCCCCACCCCAGCCAC No data
Right 1032095256 7:128935058-128935080 GTAGCTTCTACTCGAGTCAGGGG No data
1032095245_1032095256 16 Left 1032095245 7:128935019-128935041 CCCACCCCAGCCACCCCACTCTA No data
Right 1032095256 7:128935058-128935080 GTAGCTTCTACTCGAGTCAGGGG No data
1032095247_1032095256 12 Left 1032095247 7:128935023-128935045 CCCCAGCCACCCCACTCTACACT No data
Right 1032095256 7:128935058-128935080 GTAGCTTCTACTCGAGTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032095256 Original CRISPR GTAGCTTCTACTCGAGTCAG GGG Intergenic
No off target data available for this crispr