ID: 1032106337

View in Genome Browser
Species Human (GRCh38)
Location 7:129034391-129034413
Sequence TGTGGGCAGGAACACTGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032106334_1032106337 -8 Left 1032106334 7:129034376-129034398 CCAGCTACTGGGGGGTGTGGGCA 0: 1
1: 0
2: 3
3: 36
4: 497
Right 1032106337 7:129034391-129034413 TGTGGGCAGGAACACTGAGGTGG No data
1032106333_1032106337 -7 Left 1032106333 7:129034375-129034397 CCCAGCTACTGGGGGGTGTGGGC 0: 1
1: 1
2: 6
3: 69
4: 1337
Right 1032106337 7:129034391-129034413 TGTGGGCAGGAACACTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032106337 Original CRISPR TGTGGGCAGGAACACTGAGG TGG Intronic
No off target data available for this crispr