ID: 1032115704

View in Genome Browser
Species Human (GRCh38)
Location 7:129115427-129115449
Sequence TAGACTATGTTCAGCAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032115704_1032115708 27 Left 1032115704 7:129115427-129115449 CCAGTGTTGCTGAACATAGTCTA No data
Right 1032115708 7:129115477-129115499 CAGCCACAGACCTACCTGCAGGG No data
1032115704_1032115705 -4 Left 1032115704 7:129115427-129115449 CCAGTGTTGCTGAACATAGTCTA No data
Right 1032115705 7:129115446-129115468 TCTACCTGAATCTATTCTACAGG No data
1032115704_1032115707 26 Left 1032115704 7:129115427-129115449 CCAGTGTTGCTGAACATAGTCTA No data
Right 1032115707 7:129115476-129115498 TCAGCCACAGACCTACCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032115704 Original CRISPR TAGACTATGTTCAGCAACAC TGG (reversed) Intergenic
No off target data available for this crispr