ID: 1032117047

View in Genome Browser
Species Human (GRCh38)
Location 7:129126457-129126479
Sequence TGGGCCCGTAGTGGGCGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032117047_1032117060 15 Left 1032117047 7:129126457-129126479 CCGGCCCGCCCACTACGGGCCCA No data
Right 1032117060 7:129126495-129126517 CGCCACCGGCCCGCGGAGCCCGG No data
1032117047_1032117063 22 Left 1032117047 7:129126457-129126479 CCGGCCCGCCCACTACGGGCCCA No data
Right 1032117063 7:129126502-129126524 GGCCCGCGGAGCCCGGATGCTGG 0: 1
1: 1
2: 1
3: 21
4: 144
1032117047_1032117066 27 Left 1032117047 7:129126457-129126479 CCGGCCCGCCCACTACGGGCCCA No data
Right 1032117066 7:129126507-129126529 GCGGAGCCCGGATGCTGGCCCGG 0: 1
1: 4
2: 4
3: 26
4: 167
1032117047_1032117067 30 Left 1032117047 7:129126457-129126479 CCGGCCCGCCCACTACGGGCCCA No data
Right 1032117067 7:129126510-129126532 GAGCCCGGATGCTGGCCCGGAGG 0: 1
1: 1
2: 0
3: 13
4: 144
1032117047_1032117057 8 Left 1032117047 7:129126457-129126479 CCGGCCCGCCCACTACGGGCCCA No data
Right 1032117057 7:129126488-129126510 GCGCCGCCGCCACCGGCCCGCGG No data
1032117047_1032117056 1 Left 1032117047 7:129126457-129126479 CCGGCCCGCCCACTACGGGCCCA No data
Right 1032117056 7:129126481-129126503 GCTAGAGGCGCCGCCGCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032117047 Original CRISPR TGGGCCCGTAGTGGGCGGGC CGG (reversed) Intergenic