ID: 1032117090

View in Genome Browser
Species Human (GRCh38)
Location 7:129126591-129126613
Sequence TGCCTCGGAGGCGCCCTCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 72}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032117090_1032117099 14 Left 1032117090 7:129126591-129126613 CCAGCGAGGGCGCCTCCGAGGCA 0: 1
1: 0
2: 1
3: 5
4: 72
Right 1032117099 7:129126628-129126650 GCAGAAGAAGCTGGAGGAGCTGG No data
1032117090_1032117096 5 Left 1032117090 7:129126591-129126613 CCAGCGAGGGCGCCTCCGAGGCA 0: 1
1: 0
2: 1
3: 5
4: 72
Right 1032117096 7:129126619-129126641 GGTGGACCTGCAGAAGAAGCTGG No data
1032117090_1032117097 8 Left 1032117090 7:129126591-129126613 CCAGCGAGGGCGCCTCCGAGGCA 0: 1
1: 0
2: 1
3: 5
4: 72
Right 1032117097 7:129126622-129126644 GGACCTGCAGAAGAAGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032117090 Original CRISPR TGCCTCGGAGGCGCCCTCGC TGG (reversed) Intergenic
903536586 1:24071056-24071078 TGCCGGGGAGGTGGCCTCGCGGG - Intronic
903652371 1:24929927-24929949 GGCCGAGGAGGCGCCCGCGCCGG - Intronic
905500791 1:38434610-38434632 TGCCTCTGAGCCTCCCTCTCTGG + Intergenic
917538024 1:175888373-175888395 TGCCTCGGAGGGGCCTGAGCGGG + Intergenic
1065319406 10:24495236-24495258 TGCCTGGGATGAGCCCTGGCTGG + Intronic
1067853333 10:49769080-49769102 TGCCTCAGAAGCGCACGCGCAGG - Intergenic
1070162585 10:73874717-73874739 CGCCCCGGAGCCGCCCTCGCTGG + Intergenic
1070976518 10:80609802-80609824 TGCCTCTGAGGGGCCCTTGGTGG - Intronic
1072670632 10:97426489-97426511 GGCCTCGGAGGCCGCCTGGCTGG + Intronic
1084021618 11:66421190-66421212 CGCCTTGGAGGCGCCCTTGGTGG - Exonic
1084531651 11:69731171-69731193 TGCCCCGGAGGCCCCTTCCCTGG + Intergenic
1085052900 11:73388906-73388928 TGCCTGGGAGCCGGCCTCACGGG - Intronic
1094493202 12:30974092-30974114 TGCCGCAGAGGTGCCCTCCCAGG + Intronic
1097192327 12:57225439-57225461 TCCCTCGGGGGCGCACTGGCGGG + Exonic
1102521562 12:113480281-113480303 TGAATCGGCGGCGCCGTCGCCGG + Intergenic
1112475933 13:99730711-99730733 TGCCTCTGGGGCTCCCTCCCTGG - Intronic
1119728878 14:76938595-76938617 TGCCTCTGAGGCTCCCCAGCAGG - Intergenic
1122193277 14:100065243-100065265 TGCCTCTCAGCCGCCCACGCTGG + Intronic
1132890084 16:2199490-2199512 TGGCTCAGAGGCCCCCTCCCAGG - Intergenic
1134826360 16:17287612-17287634 TGCCTCTGGGGAGCCCTCCCAGG + Intronic
1138179309 16:54931354-54931376 TGCCTTCACGGCGCCCTCGCCGG + Exonic
1139705526 16:68738077-68738099 TGACTCGGCGGCCCCCTCCCGGG + Intronic
1142155335 16:88530331-88530353 TGCCTCGGTTTCCCCCTCGCGGG + Intronic
1145251399 17:21298749-21298771 TGCCCCGGAGGCGCCTTCTCCGG - Intronic
1146229348 17:31094856-31094878 TGCCGCGCATGCGCCCGCGCCGG - Intergenic
1148336054 17:46842010-46842032 GGCCGCGGTGGCGCCCTCGGCGG + Intronic
1150314169 17:64154898-64154920 TTCCTCGGAGGAGCCAGCGCTGG + Exonic
1153935236 18:9914626-9914648 CGCCCAGGAGGCGCCCCCGCGGG - Intronic
1154494299 18:14944536-14944558 TGACTGGGAAGGGCCCTCGCTGG - Intergenic
1160583743 18:79901544-79901566 TCCCACGGAGGGGCCCTCACTGG + Intergenic
1160735466 19:660366-660388 TGCCTGGGAGAAGCCCTCGTGGG + Intronic
1161412384 19:4123780-4123802 TCACTCGGAGGCGCCCTCGCTGG + Exonic
1161481094 19:4510996-4511018 AGCCTTGGAGGCGTCCACGCCGG + Exonic
1162481461 19:10929152-10929174 CTCCTCGAAGGCACCCTCGCTGG - Exonic
1165553186 19:36605612-36605634 TCCCGCGGAAGCGCCATCGCTGG + Intronic
1167532260 19:50025402-50025424 TGAATCTGAGGCGCCCGCGCAGG + Exonic
926581576 2:14635572-14635594 TGCCTGCGAGTCTCCCTCGCTGG + Exonic
926698752 2:15788625-15788647 TGCCTGGGAGGCGGCCTCCTTGG - Intergenic
927922447 2:26983515-26983537 TGCCTCTGAGGCCCTCTCGAAGG + Intronic
931467624 2:62505623-62505645 TGCCTCTGCGGCGCCCGCCCCGG - Intronic
932306356 2:70706360-70706382 TGCCTCGCCGCCGCCCCCGCAGG - Exonic
935904518 2:107827916-107827938 TGGCCCGGAGGCGGCCTCGATGG + Intronic
945066269 2:205949896-205949918 TGCCTCCCGGGCTCCCTCGCTGG - Intergenic
1173582902 20:44159959-44159981 GGCCTCGTCGGCGCCCTCGGCGG + Exonic
1173913531 20:46689091-46689113 AGCCTCGGGGCCGCCCACGCCGG + Intronic
1174386738 20:50191786-50191808 GGCCGCGCCGGCGCCCTCGCAGG + Exonic
1174395304 20:50243366-50243388 TGCCTGGGAGGCATCCTGGCTGG - Intergenic
1175927640 20:62478887-62478909 CGCCTCGGAGGAGCCTTCGAAGG - Intergenic
1180096336 21:45556975-45556997 GGCCTCTGAGGCGCCGTCCCAGG - Intergenic
1181478183 22:23181208-23181230 GGGCTCGGAGGCGCCGTCGGGGG - Exonic
1182288271 22:29260490-29260512 TGCCTCTGAGGAGCCCTCCCAGG + Exonic
1183236021 22:36618285-36618307 TGCCTCTGAGGGGCCCCTGCAGG - Intronic
1184723516 22:46329740-46329762 TGCCTCTGAGGTGCCCTGCCAGG + Intronic
952764690 3:36944409-36944431 TGCCCCGGGGGCGCGCTCGCTGG + Intronic
953910169 3:46888844-46888866 TGCCCCGAAGGCGGCCACGCTGG + Intronic
954618660 3:51983496-51983518 GACCTCGCAGGCGACCTCGCTGG + Exonic
964296543 3:155240066-155240088 TCCCTCAGAGGCACCCTGGCTGG + Intergenic
966794040 3:183697678-183697700 TGCCCAGGAAGTGCCCTCGCGGG + Intergenic
968689059 4:1980769-1980791 GGCCTCTGAGGGGCACTCGCCGG + Exonic
968764730 4:2462470-2462492 GGCCCCGGCGGCGCCCTCGCAGG + Exonic
985688504 5:1294544-1294566 GGCCTCGGGGGGGCCCCCGCGGG + Exonic
986042864 5:4010689-4010711 CGCCTGGGAGGGGCCCACGCAGG - Intergenic
989480465 5:41925177-41925199 TGCCCTGGAGGCGGACTCGCGGG + Intergenic
998236396 5:140402048-140402070 GGCCTCGGAGCCGCCTCCGCCGG + Exonic
998415823 5:141945531-141945553 CGCCTCGGAGGCGGCCTCCACGG + Exonic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1003367072 6:5484985-5485007 GGCCCCGGAGGAGCCCTCCCTGG + Intronic
1007073971 6:39055090-39055112 TGCCTCGGAGGCCCCATGGAAGG - Intronic
1021905226 7:25326714-25326736 TGGCTCTGAGACGCCATCGCAGG - Intergenic
1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG + Exonic
1029098361 7:98107065-98107087 TGCCTCAGTGGCACCCGCGCCGG - Exonic
1029365194 7:100112117-100112139 GGCCTCGCAGGAGCCCACGCAGG + Exonic
1029539072 7:101172532-101172554 TGCCTCGGACACGGCCTCGGTGG + Exonic
1032117090 7:129126591-129126613 TGCCTCGGAGGCGCCCTCGCTGG - Intergenic
1033529159 7:142245607-142245629 TGCCTCCGAGGCTCACTTGCTGG + Intergenic
1057490623 9:95516989-95517011 TTCCTGGGAGGCGCCCTGCCCGG + Intronic
1187507125 X:19887210-19887232 TGCCCCCGGGGCGCCCTCCCGGG + Intronic
1189196815 X:39160378-39160400 TGCCTGGGAGGGGCCCTAGGAGG - Intergenic
1200179942 X:154144061-154144083 TCCCTCTGAGCCGCCCTTGCGGG + Intergenic