ID: 1032118187

View in Genome Browser
Species Human (GRCh38)
Location 7:129135268-129135290
Sequence ACTTATCTTCAGGGAGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032118182_1032118187 -7 Left 1032118182 7:129135252-129135274 CCCAGTTTAGATCAGGACTTATC No data
Right 1032118187 7:129135268-129135290 ACTTATCTTCAGGGAGTGGATGG No data
1032118183_1032118187 -8 Left 1032118183 7:129135253-129135275 CCAGTTTAGATCAGGACTTATCT No data
Right 1032118187 7:129135268-129135290 ACTTATCTTCAGGGAGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032118187 Original CRISPR ACTTATCTTCAGGGAGTGGA TGG Intergenic
No off target data available for this crispr