ID: 1032119208

View in Genome Browser
Species Human (GRCh38)
Location 7:129144638-129144660
Sequence GCCACGAGCCAATGGGAAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032119203_1032119208 21 Left 1032119203 7:129144594-129144616 CCGACTCTCGGTGGAGAGGGATG No data
Right 1032119208 7:129144638-129144660 GCCACGAGCCAATGGGAAGTCGG No data
1032119202_1032119208 22 Left 1032119202 7:129144593-129144615 CCCGACTCTCGGTGGAGAGGGAT No data
Right 1032119208 7:129144638-129144660 GCCACGAGCCAATGGGAAGTCGG No data
1032119199_1032119208 24 Left 1032119199 7:129144591-129144613 CCCCCGACTCTCGGTGGAGAGGG No data
Right 1032119208 7:129144638-129144660 GCCACGAGCCAATGGGAAGTCGG No data
1032119201_1032119208 23 Left 1032119201 7:129144592-129144614 CCCCGACTCTCGGTGGAGAGGGA No data
Right 1032119208 7:129144638-129144660 GCCACGAGCCAATGGGAAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032119208 Original CRISPR GCCACGAGCCAATGGGAAGT CGG Intergenic
No off target data available for this crispr