ID: 1032122009

View in Genome Browser
Species Human (GRCh38)
Location 7:129163433-129163455
Sequence GAGACTTAGGAGATGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1823
Summary {0: 1, 1: 0, 2: 5, 3: 113, 4: 1704}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032122009_1032122017 20 Left 1032122009 7:129163433-129163455 CCTGCCTCCATCTCCTAAGTCTC 0: 1
1: 0
2: 5
3: 113
4: 1704
Right 1032122017 7:129163476-129163498 ACCATGATTGGCTTAATAAAAGG No data
1032122009_1032122015 8 Left 1032122009 7:129163433-129163455 CCTGCCTCCATCTCCTAAGTCTC 0: 1
1: 0
2: 5
3: 113
4: 1704
Right 1032122015 7:129163464-129163486 CAGTCATGTGCCACCATGATTGG 0: 1
1: 8
2: 641
3: 8129
4: 33381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032122009 Original CRISPR GAGACTTAGGAGATGGAGGC AGG (reversed) Intronic
900206631 1:1434491-1434513 GAGGCTGAGGAGCTGGCGGCAGG - Intergenic
900536881 1:3183080-3183102 ATGACTTTGGAGATGCAGGCTGG - Intronic
900838345 1:5024589-5024611 GCTACTTAGGAGACTGAGGCAGG + Intergenic
900882463 1:5391992-5392014 GAGACTCAGGAGCTGGACTCTGG - Intergenic
900887882 1:5428315-5428337 GAGCCTTAGTAGTTGGAGACGGG - Intergenic
900997952 1:6133004-6133026 GCGACTTGGGAGGTTGAGGCAGG - Intronic
901131190 1:6963167-6963189 GAGCCAAAAGAGATGGAGGCTGG - Intronic
901159370 1:7163322-7163344 GAGACCAAGGAGCGGGAGGCCGG + Intronic
901245076 1:7723929-7723951 GCTACTTGGGAGATTGAGGCAGG - Intronic
901259633 1:7862022-7862044 GCTACTTAGGAGACTGAGGCAGG - Intergenic
901375888 1:8839141-8839163 GATACTCAGGAGACTGAGGCAGG + Intergenic
901470246 1:9450918-9450940 GCTACTTGGGAGATTGAGGCAGG + Intergenic
901501462 1:9654953-9654975 GCTACTTGGGAGGTGGAGGCAGG + Intronic
901748227 1:11388791-11388813 GAGACTAAGGAGATGGCGATGGG - Intergenic
901799392 1:11698743-11698765 GCTACTTAGGAGACTGAGGCAGG + Intronic
902041960 1:13499208-13499230 GCTACTCGGGAGATGGAGGCAGG - Intronic
902054762 1:13591051-13591073 GCTACTCAGGAGACGGAGGCAGG - Intronic
902379966 1:16048234-16048256 GGGGCTTGGGAGATGGAGGAGGG + Intronic
902390467 1:16101358-16101380 GATACTTGGGAGGTCGAGGCAGG + Intergenic
902594265 1:17497453-17497475 GAGACTCAGAAGAGGGAGGATGG - Intergenic
902656262 1:17870483-17870505 GCTACTTGGGAGATAGAGGCTGG - Intergenic
902908330 1:19576025-19576047 GTGACTCAGGAGACTGAGGCAGG - Intergenic
902910217 1:19590512-19590534 GCTACTTGGGAGTTGGAGGCAGG + Intergenic
902974705 1:20080468-20080490 GATACTTAGGAGGTTGAGGCAGG + Intronic
903095687 1:20970850-20970872 GCTACTTGGGAGATTGAGGCAGG + Intronic
903109284 1:21115826-21115848 GATACTTGGGAGACTGAGGCAGG - Intronic
903167452 1:21530890-21530912 GCTACTTAGGAGACTGAGGCAGG - Intronic
903279487 1:22242391-22242413 GAGATTTGAGAGATGGAGACAGG + Intergenic
903280232 1:22245960-22245982 GCGGCTTAGGAGAGGGAGGGAGG + Intergenic
903294045 1:22332446-22332468 GAGACTTGGGAGGAGAAGGCTGG - Intergenic
903366758 1:22810199-22810221 GAGACACAGGAGATGGGAGCGGG + Intronic
903517175 1:23919191-23919213 GCTACTTAGGAGGTTGAGGCAGG + Intergenic
903534132 1:24055516-24055538 GATACTCAGGAGGTTGAGGCGGG + Intergenic
903926812 1:26836263-26836285 GAGACAAAGGAGATGGGGTCTGG - Intronic
903933199 1:26876325-26876347 GCTACTTAGGAGACTGAGGCAGG - Exonic
904149193 1:28423033-28423055 GCAATTTGGGAGATGGAGGCAGG - Intronic
904682306 1:32237842-32237864 GAGATTTAGAAGATTGTGGCTGG - Intergenic
904837965 1:33350957-33350979 GGAACTTAAGAGAGGGAGGCAGG - Intronic
904960340 1:34327674-34327696 GCTACTTAGGAGGTTGAGGCAGG + Intergenic
905088692 1:35408623-35408645 GCTACTCAGGAGACGGAGGCAGG + Intronic
905114920 1:35630061-35630083 GCTACTTGGGAAATGGAGGCAGG + Intronic
905326784 1:37158611-37158633 AAGACTTAGGAGTTGGAAGGTGG + Intergenic
905469918 1:38183990-38184012 GCTACTCAGGAGATTGAGGCAGG + Intergenic
905587374 1:39131273-39131295 CTTACTCAGGAGATGGAGGCAGG - Intronic
905720316 1:40194526-40194548 GCTACTTGGGAGATTGAGGCAGG + Intronic
905769417 1:40627849-40627871 GAGACTCGGGAGACTGAGGCAGG - Intronic
905913722 1:41671107-41671129 GAGGCTTAGGAGAGGCAGGGTGG - Intronic
906031500 1:42723886-42723908 GCTACTTAGGAGGTTGAGGCAGG + Intergenic
906064374 1:42969616-42969638 GCTACTTAGGAGACTGAGGCAGG + Intergenic
906076441 1:43055610-43055632 GAGACTTGGGAGGCTGAGGCAGG - Intergenic
906111556 1:43326508-43326530 GCTACTTAGGAGACTGAGGCAGG + Intergenic
906173548 1:43748538-43748560 GATACTTAGGAGGCTGAGGCAGG - Intronic
906338793 1:44959428-44959450 GCTACTTAGGAGACTGAGGCTGG + Intronic
906443976 1:45877336-45877358 GCTACTCAGGAGATTGAGGCAGG - Intronic
906574054 1:46871712-46871734 GCGACTCAGGAGACAGAGGCAGG - Intergenic
906599383 1:47111293-47111315 GCTACTTGGGAGGTGGAGGCAGG - Intronic
906630685 1:47364872-47364894 GCTACTTAGGAGTTTGAGGCAGG - Intronic
906742569 1:48196992-48197014 GCTACTTAGGAGACTGAGGCAGG + Intergenic
907132050 1:52105631-52105653 GATACTTAGGAGGCTGAGGCAGG + Intergenic
907478420 1:54724375-54724397 GCTACTCAGGAGATTGAGGCAGG - Intronic
907540164 1:55208515-55208537 GCTACTTAGGAGGTTGAGGCAGG + Intronic
907603343 1:55791858-55791880 GGTACTTGGGAGATAGAGGCAGG + Intergenic
907688320 1:56636128-56636150 GAGACTTGGGAGGTTGAGGCAGG - Intronic
907717443 1:56940456-56940478 GCTACTTAGGAGGTTGAGGCAGG + Intronic
907839820 1:58145932-58145954 GAGGCTGAGGAGAAGGAGGAGGG - Intronic
908340589 1:63174214-63174236 GCTACTTAGGAGACTGAGGCAGG + Intergenic
908392981 1:63700163-63700185 GCTACTTGGGAGATGAAGGCAGG - Intergenic
908756108 1:67470276-67470298 GCTACTCAGGAGATTGAGGCAGG + Intergenic
908764176 1:67539494-67539516 GAGACGGAGGAGGTGGAGGGAGG + Intergenic
908787221 1:67747229-67747251 GCTACTCAGGAGATTGAGGCAGG - Intronic
909577582 1:77192021-77192043 GCTACTCAGGAGATTGAGGCAGG + Intronic
909804807 1:79860603-79860625 GCTACTGAGGAGATTGAGGCAGG + Intergenic
909946451 1:81669300-81669322 GATACTGAGGAGACTGAGGCGGG + Intronic
910271509 1:85400301-85400323 GCTACTCAGGAGATTGAGGCAGG - Intronic
910607494 1:89102814-89102836 GCCACTTGGGAGGTGGAGGCAGG + Intergenic
910754477 1:90672788-90672810 GTTACTCAGGAGATAGAGGCAGG - Intergenic
910837557 1:91531119-91531141 GCTACTTAGGAGGTTGAGGCAGG - Intergenic
910877510 1:91891007-91891029 GCTACTTAGGAGGTGGAGGCAGG - Intronic
911018163 1:93357392-93357414 GTTACTCGGGAGATGGAGGCAGG + Intronic
911036681 1:93557620-93557642 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
911196862 1:95003559-95003581 GCTACTCAGGAGGTGGAGGCAGG - Intronic
911770182 1:101731418-101731440 GCTACTTAGGAGACTGAGGCAGG - Intergenic
911878134 1:103196223-103196245 GCTACTTGGGAGGTGGAGGCAGG - Intergenic
912025262 1:105162043-105162065 GCTACTCAGGAGAGGGAGGCAGG - Intergenic
912417615 1:109520805-109520827 CAGACTCAGGAGATTGAAGCGGG - Intergenic
913170520 1:116227935-116227957 GCTACTTGGGAGGTGGAGGCAGG + Intergenic
913217709 1:116634483-116634505 GTGACTGAGGAGATGTGGGCAGG - Intronic
913576249 1:120178072-120178094 GAGACTTAGAAGGCGGAGGGTGG - Intergenic
914216804 1:145638386-145638408 GCTACTCAGGAGATGGAGGCAGG + Intronic
914243229 1:145866796-145866818 GAGACTGAGGATATGGAAGTGGG - Intronic
914469372 1:147961067-147961089 GCTACTCAGGAGATGGAGGCAGG + Intronic
914737205 1:150429202-150429224 GCTACTTGGGAGATTGAGGCAGG - Intronic
914800338 1:150957003-150957025 GCTACTTAGGAGACTGAGGCAGG + Intronic
914820208 1:151095919-151095941 GCTACTTGGGTGATGGAGGCAGG + Intronic
914876390 1:151515583-151515605 GCGACTTAGGAGGCTGAGGCAGG - Intronic
914903458 1:151725220-151725242 GCTACTTGGGAGGTGGAGGCAGG - Intronic
915015670 1:152730895-152730917 GCTACTTGGGAGATTGAGGCAGG + Intergenic
915031241 1:152882085-152882107 GATACTTGGGAGACTGAGGCAGG - Intronic
915139075 1:153755373-153755395 GCTACTTGGGAGATTGAGGCAGG - Intronic
915365633 1:155313928-155313950 GCTACTTAGGAGACTGAGGCAGG - Intronic
915372314 1:155361403-155361425 GCTACTTAGGAGGTTGAGGCAGG + Intronic
915468080 1:156109393-156109415 GAGAAGTGGGAGGTGGAGGCAGG - Intronic
915480498 1:156181258-156181280 GATACTTAGGAGGCTGAGGCAGG + Intergenic
915622491 1:157094323-157094345 GAGACAGAGAAGAAGGAGGCTGG - Intronic
916080250 1:161227750-161227772 GTGCCTCAGGGGATGGAGGCAGG - Intronic
916169083 1:161987109-161987131 CAGACTTTGGAGTTGGTGGCTGG - Intronic
916233000 1:162559004-162559026 GCTACTTAGGAGGTTGAGGCAGG - Intergenic
916256505 1:162793144-162793166 GCTACTCAGGAGGTGGAGGCAGG - Intronic
916501896 1:165394467-165394489 GCTACTTAGGAGACTGAGGCAGG + Intergenic
916549307 1:165834383-165834405 GAGCCTTGGGAGGTTGAGGCTGG + Intronic
916621724 1:166505298-166505320 GCCACTTGGGAGATGGAGGCAGG - Intergenic
916833874 1:168521580-168521602 TAGAGGTTGGAGATGGAGGCAGG + Intergenic
917309607 1:173665285-173665307 GCTACTTGGGAGGTGGAGGCAGG - Intronic
917321902 1:173791440-173791462 GATACTTGGGAGATTGAGGTGGG + Intergenic
917538311 1:175890435-175890457 GCTACTCAGGAGATTGAGGCAGG + Intergenic
917698156 1:177550769-177550791 GCGACTCAGGAGGTTGAGGCAGG + Intergenic
917757578 1:178118050-178118072 GCTACTTAGGAGGTTGAGGCAGG + Intronic
917797789 1:178544082-178544104 GCTACTTGGGAGATTGAGGCAGG - Intronic
917889637 1:179422873-179422895 GCTACTTGGGAGATGGAGGCAGG - Intronic
918045858 1:180940821-180940843 GCTACTCGGGAGATGGAGGCGGG - Intronic
918266230 1:182844643-182844665 GCTACTTAGGAGACTGAGGCAGG - Intronic
918308088 1:183265376-183265398 GCTACTTAGGAGACTGAGGCAGG - Intronic
918476902 1:184934781-184934803 GATACTTAGGAGGCTGAGGCAGG + Intronic
918499381 1:185176870-185176892 GCTACTTGGGAGATTGAGGCAGG + Intronic
918555265 1:185791608-185791630 GCTACTCAGGAGGTGGAGGCAGG + Intronic
918604836 1:186410901-186410923 GCTACTCAGGAGGTGGAGGCAGG + Intronic
918698690 1:187579625-187579647 GCTACTCAGGAGATTGAGGCAGG + Intergenic
918737679 1:188086865-188086887 GATACTCAGGAGACTGAGGCAGG - Intergenic
918957732 1:191231965-191231987 GCTACTTGGGAGGTGGAGGCAGG + Intergenic
919578768 1:199344711-199344733 GATACTTCGGAGACTGAGGCAGG + Intergenic
919917692 1:202148965-202148987 GCTACTCAGGAGATTGAGGCAGG - Intronic
920121720 1:203663848-203663870 GAGACTCAGGAGGCCGAGGCAGG - Intronic
920317622 1:205089961-205089983 GCTACTTAGGAGGTTGAGGCAGG - Intronic
920400734 1:205674825-205674847 GCTACTTGGGAGGTGGAGGCAGG - Intronic
920430682 1:205916852-205916874 GGCACTTAGGAGACCGAGGCAGG + Intronic
921279224 1:213549259-213549281 GAGTCTTAGGTGGTGGAGGAAGG + Intergenic
921318334 1:213913439-213913461 GTGACTCAGGAGACTGAGGCAGG - Intergenic
921382223 1:214535665-214535687 GCTACTTAGGAGGTTGAGGCAGG + Intronic
921437082 1:215136205-215136227 GCTACTCAGGAGATTGAGGCAGG - Intronic
921653026 1:217701495-217701517 GCAACTTGGGAGATTGAGGCAGG - Intronic
921790514 1:219284813-219284835 GAGAGTTGGGGAATGGAGGCAGG - Intergenic
921921075 1:220670183-220670205 GCTACTTGGGAGATGGAGGTGGG + Intergenic
922043437 1:221919540-221919562 GAGACTGAGCAGATGCTGGCAGG + Intergenic
922101650 1:222482134-222482156 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
922262730 1:223957250-223957272 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
922673015 1:227528277-227528299 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
922743049 1:228026613-228026635 GAGACTCAGAAGAGGGAGGTTGG - Intronic
922978677 1:229806164-229806186 GGGACTCAGGAGGTTGAGGCAGG + Intergenic
923121182 1:230993200-230993222 GCTACTCAGGAGACGGAGGCAGG - Intronic
923320714 1:232830381-232830403 GCTACTTAGGAGACTGAGGCAGG + Intergenic
923676520 1:236085119-236085141 GTGACTTAGGAGGCTGAGGCAGG + Intergenic
924005951 1:239611530-239611552 GCTACTTAGGAGGTGGAGGCGGG - Intronic
924120875 1:240796572-240796594 GCTACTTAGGAGGTTGAGGCAGG + Intronic
924123650 1:240827750-240827772 GATACTTAGGAGGCTGAGGCAGG + Intronic
924258884 1:242209904-242209926 GCTACTCAGGAGATTGAGGCAGG - Intronic
924286403 1:242492408-242492430 GCTACTCAGGAGATTGAGGCAGG + Intronic
924344568 1:243062251-243062273 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
924371487 1:243355715-243355737 GCTACTTGGGAGGTGGAGGCGGG - Intronic
924441823 1:244092610-244092632 GAGACTGGGTAGATGGAGGTAGG - Intergenic
924651168 1:245928560-245928582 GCTACTCAGGAGGTGGAGGCAGG + Intronic
924806318 1:247364585-247364607 GCTACTTAGGAGATTGAGGCAGG + Intergenic
1063128403 10:3155505-3155527 GTGAGTTAGTAGTTGGAGGCAGG - Intronic
1063417347 10:5884618-5884640 GCTACTTAGGAGGTTGAGGCAGG + Intronic
1063690056 10:8278604-8278626 GCTACTTGGGAGATTGAGGCAGG - Intergenic
1063826411 10:9903536-9903558 GCTACTTGGGAGGTGGAGGCAGG - Intergenic
1063845717 10:10124957-10124979 GCTACTTGGGAGGTGGAGGCAGG - Intergenic
1064072566 10:12243284-12243306 GCTACTTAGGAGGTGGAGGCAGG + Intronic
1064415431 10:15145489-15145511 GATACTTGGGAGACTGAGGCAGG - Intronic
1064443879 10:15376494-15376516 GTTACTTAGGAGACTGAGGCAGG - Intergenic
1064469578 10:15622044-15622066 GGTACTTGGGAGGTGGAGGCAGG + Intronic
1064506647 10:16038166-16038188 GAGACTCAGAAGAGGAAGGCTGG + Intergenic
1064540617 10:16401878-16401900 GCTTCTCAGGAGATGGAGGCAGG - Intergenic
1064614167 10:17135491-17135513 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
1064771351 10:18726960-18726982 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1065016920 10:21470660-21470682 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
1065358010 10:24861386-24861408 GCCACTTGGGAGATTGAGGCAGG + Intronic
1065766363 10:29033884-29033906 GATACTTGGGAGGTTGAGGCAGG - Intergenic
1065854611 10:29820273-29820295 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1065942002 10:30573461-30573483 GCTACTCGGGAGATGGAGGCAGG - Intergenic
1066066845 10:31767715-31767737 AGCACTTTGGAGATGGAGGCGGG - Intergenic
1066229584 10:33419402-33419424 GAGAGTTAGGAGGAGGAAGCTGG + Intergenic
1066298980 10:34080171-34080193 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
1066408487 10:35143080-35143102 GCTACTTGGGAGGTGGAGGCAGG - Intronic
1066550059 10:36546052-36546074 GCTACTTAGGAGACTGAGGCAGG + Intergenic
1066688883 10:38007235-38007257 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
1066722963 10:38358798-38358820 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
1066731763 10:38442821-38442843 GAGAATTAGGGGAGGGAGCCAGG + Intergenic
1067014380 10:42745845-42745867 GTACTTTAGGAGATGGAGGCGGG - Intergenic
1067113707 10:43418911-43418933 GCTACTTGGGAGATTGAGGCGGG - Intergenic
1067302041 10:45020848-45020870 GTTACTTGGGAGGTGGAGGCAGG - Intergenic
1067489723 10:46687186-46687208 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1067604944 10:47653198-47653220 GCTACTCAGGAGATTGAGGCAGG + Intergenic
1067909641 10:50332870-50332892 AAGACAGAGGAGGTGGAGGCAGG - Intronic
1068047055 10:51899544-51899566 GCTACTTAGGAGACTGAGGCAGG + Intronic
1068671738 10:59730120-59730142 TAGTGTTGGGAGATGGAGGCTGG + Intronic
1068755318 10:60646462-60646484 GCTACTTAGGAGATGGAGGCAGG + Intronic
1069025371 10:63534360-63534382 GCTACTTAGGAGGTGGAAGCAGG - Intronic
1069216617 10:65829062-65829084 GCTACTTGGGAGATTGAGGCAGG + Intergenic
1069322215 10:67185906-67185928 GCTACTTGGGAGATTGAGGCAGG + Intronic
1069407567 10:68118583-68118605 GAGCTTTGGGAGATGGAGGTGGG + Intronic
1069432425 10:68349648-68349670 GGTACTTAGGAGACTGAGGCAGG - Intronic
1069506386 10:69002052-69002074 GCTACTTGGGAGATTGAGGCAGG + Intronic
1069509561 10:69031672-69031694 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1069532202 10:69227676-69227698 GATACTTCCTAGATGGAGGCAGG - Intronic
1069565483 10:69460796-69460818 GAGTCTTAGGAGAGGGAGGGCGG + Intronic
1069585989 10:69602732-69602754 GACTCTTAGGAGCTGGGGGCTGG - Intergenic
1069652417 10:70059480-70059502 GCTACTTAGGAGGTTGAGGCAGG - Intronic
1069786119 10:70988986-70989008 GGAACTTAGGAGTTGGAGGGTGG + Intergenic
1069982645 10:72262992-72263014 GCTACTTAGGAGGCGGAGGCAGG + Intergenic
1070117461 10:73542617-73542639 GCTACTTGGGAGATGGAGGCAGG + Intronic
1070146369 10:73776567-73776589 GATACTTGGGAGGTTGAGGCAGG + Intronic
1070254490 10:74802505-74802527 GCTACTTAGGAGGTGGAGGCAGG - Intergenic
1070363819 10:75716698-75716720 GAGACACATGAGAAGGAGGCAGG - Intronic
1070805090 10:79266215-79266237 AAGTCTTAGGAGTGGGAGGCAGG + Intronic
1070899511 10:80015977-80015999 GATACTTGGGAGGTTGAGGCAGG - Intergenic
1070991290 10:80734432-80734454 GCTACTTAGGAGACAGAGGCAGG + Intergenic
1071329916 10:84549032-84549054 GAGACTGGGGAGCTGGAGGATGG - Intergenic
1071620499 10:87114611-87114633 GCTACTCAGGAGATTGAGGCAGG + Intronic
1072231371 10:93416707-93416729 GCTACTTGGGAGATTGAGGCTGG - Intronic
1072301019 10:94062401-94062423 GCTACTTGGGAGATTGAGGCAGG - Intronic
1072653655 10:97315446-97315468 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1072661213 10:97364603-97364625 GATACTTGGGAGACTGAGGCAGG + Intronic
1072736590 10:97883352-97883374 GAGACTTAAGAGTTGGGAGCCGG + Intronic
1072803574 10:98409964-98409986 GCTACTCAGGAGATTGAGGCAGG + Intronic
1073081356 10:100862961-100862983 GCTACTTGGGAGGTGGAGGCAGG + Intergenic
1073275096 10:102303097-102303119 GCTACTTGGGAGGTGGAGGCAGG - Intronic
1073443577 10:103567610-103567632 GAGACCTAGGAGTTGGAGACCGG - Intronic
1073576392 10:104629613-104629635 GAGATTAAGGAGATGGGGACAGG + Intergenic
1073731905 10:106298484-106298506 GCGACTTAGGAGGCTGAGGCAGG + Intergenic
1073770268 10:106728141-106728163 GCGACTTGGGAGGTGGAGGCAGG - Intronic
1074100547 10:110351378-110351400 GATACTCAGGAGTTTGAGGCAGG + Intergenic
1074210985 10:111334966-111334988 GAGACTTAGAAGACGGCTGCTGG + Intergenic
1074236666 10:111591528-111591550 GATACTCAGGAGGTTGAGGCAGG - Intergenic
1074559314 10:114520863-114520885 GGGACTCAGGAGACTGAGGCAGG + Intronic
1074856095 10:117474658-117474680 GGGCCATAGGAGATGGAGGATGG + Intergenic
1074899271 10:117802554-117802576 GCTACTTAGGAGGTTGAGGCAGG + Intergenic
1075222224 10:120595061-120595083 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1075870442 10:125769274-125769296 GAGACTGATGTGATGGAGCCTGG - Intronic
1076268758 10:129132291-129132313 GATCCTTAGAAGAGGGAGGCAGG - Intergenic
1076296656 10:129391105-129391127 GCTACTTAGGAGACTGAGGCAGG + Intergenic
1076871708 10:133197934-133197956 GAGTTTTGGGAGATGGGGGCTGG - Intronic
1077135948 11:998803-998825 GCTACTCAGGAGGTGGAGGCAGG - Intronic
1077136409 11:1001571-1001593 AGGACTTAGGAGAGGCAGGCCGG + Intronic
1077432600 11:2523303-2523325 GCCACTCAGGAGATTGAGGCAGG - Intronic
1077547758 11:3183141-3183163 GTGACTGAGGAGGTTGAGGCAGG - Intergenic
1078051988 11:7973784-7973806 GCTACTTAGGAGATTGAGGCAGG - Intronic
1078186789 11:9058482-9058504 GATACTCAGGAGGTTGAGGCAGG + Intronic
1078215033 11:9304767-9304789 GCTACTTGGGAGATTGAGGCAGG - Intronic
1078257056 11:9667360-9667382 GCTACTTGGGAGGTGGAGGCTGG - Intronic
1078257847 11:9675205-9675227 TGAACTCAGGAGATGGAGGCTGG + Intronic
1078431775 11:11293651-11293673 GCTACTCAGGAGACGGAGGCAGG - Intronic
1078440149 11:11358069-11358091 TGGGCATAGGAGATGGAGGCAGG - Intronic
1078563654 11:12394977-12394999 GCTACTTGGGAGGTGGAGGCAGG + Intronic
1078724655 11:13919164-13919186 GAGACCTTGGAGATGTAGGGAGG + Intergenic
1078784471 11:14474982-14475004 GCTACTCAGGAGATTGAGGCAGG + Intronic
1078911846 11:15739904-15739926 GAGCTTTGGGAGGTGGAGGCGGG - Intergenic
1079054011 11:17189501-17189523 GATACTCAGGAGACTGAGGCTGG + Intronic
1079054704 11:17195629-17195651 GCTACTTAGGAGACTGAGGCAGG + Intronic
1079056674 11:17212078-17212100 GCAACTTAGGAGACTGAGGCAGG + Intronic
1079187727 11:18252598-18252620 GATACTTAGGAGGCTGAGGCAGG + Intergenic
1079306991 11:19332156-19332178 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
1079397610 11:20079150-20079172 GCTACTCAGGAGGTGGAGGCAGG - Intronic
1080126239 11:28737153-28737175 GAGTCTTGGGAGGTAGAGGCTGG + Intergenic
1080254265 11:30271481-30271503 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1080471317 11:32548450-32548472 GCTACTTGGGAGATGGAGGTGGG - Intergenic
1080536108 11:33223402-33223424 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1080651623 11:34227160-34227182 GCTACTCAGGAGATTGAGGCAGG + Intronic
1080772161 11:35351745-35351767 GCTACTCAGGAGATTGAGGCAGG - Intronic
1080890286 11:36403147-36403169 GACACTGAGGAAATGGAGGATGG + Intronic
1080958283 11:37127732-37127754 GTAACTTAGCAGCTGGAGGCTGG + Intergenic
1081128600 11:39348878-39348900 GAGACTTGGGAGGCTGAGGCAGG + Intergenic
1081180033 11:39973530-39973552 GATACTTAGGAGGCTGAGGCAGG + Intergenic
1081320402 11:41685263-41685285 GGTACTTAGGAGACTGAGGCAGG + Intergenic
1081590960 11:44422826-44422848 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1081980358 11:47262265-47262287 GCTACTTGGGAGATCGAGGCAGG + Intronic
1082008094 11:47431795-47431817 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
1082643671 11:55694698-55694720 GCTACTTGGGAGATTGAGGCAGG + Intergenic
1082977528 11:59087733-59087755 GATACTCAGGAGATGGAGGTGGG + Intergenic
1083176671 11:60954499-60954521 GGTACCTTGGAGATGGAGGCTGG - Intergenic
1083243838 11:61410207-61410229 GCTACTTAGGAGGTGGAGGTGGG - Intronic
1083252966 11:61480281-61480303 TGAACTTAGGAGTTGGAGGCTGG + Intronic
1083833827 11:65251365-65251387 GCTACTCAGGAGTTGGAGGCAGG - Intergenic
1083996200 11:66274084-66274106 GTGACTTAGGAGACTGAAGCAGG - Intronic
1084078566 11:66802262-66802284 GCTACTCAGGAGATTGAGGCAGG - Intronic
1084107639 11:66990370-66990392 GAGACTGAGTTGTTGGAGGCTGG - Intergenic
1084226737 11:67720187-67720209 GCTACTCAGGAGATGGAGGCAGG + Intergenic
1084283203 11:68113195-68113217 GATACTTGGGAGACTGAGGCAGG + Intronic
1084306252 11:68285973-68285995 GCGACTTAGGAGGCTGAGGCAGG - Intergenic
1084306960 11:68292121-68292143 GCTACTTAGGAGACTGAGGCAGG + Intergenic
1084442849 11:69185782-69185804 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1084499804 11:69528740-69528762 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG + Intergenic
1084626807 11:70313904-70313926 GATACTTGGGAGACTGAGGCAGG + Intronic
1084664675 11:70569999-70570021 GAGACTCAACAGCTGGAGGCAGG - Intronic
1084699051 11:70774429-70774451 GCTACTCAGGAGGTGGAGGCAGG - Intronic
1084812587 11:71623289-71623311 GCTACTTGGGAGGTGGAGGCAGG - Intergenic
1084872514 11:72107875-72107897 AAGACATGGGAGATGGATGCAGG - Intronic
1084976578 11:72803079-72803101 GCCACTTGGGAGATTGAGGCAGG + Intergenic
1085100627 11:73796953-73796975 GCTACTTAGGAGGTCGAGGCAGG + Intronic
1085121021 11:73967631-73967653 GATACTCAGGAGACTGAGGCAGG + Intronic
1085307597 11:75496890-75496912 GAGACTCAGGAGGCTGAGGCGGG - Intronic
1085357541 11:75853020-75853042 GCTACTTGGGAGATGGAGGCAGG - Intronic
1085370792 11:76002963-76002985 GATACTTAGGAGGCTGAGGCAGG + Intronic
1085509617 11:77081688-77081710 GAGGCTCAGGAGCTGGAGGAGGG + Intronic
1085662198 11:78378735-78378757 ACTACTTGGGAGATGGAGGCAGG - Intronic
1086467029 11:87064770-87064792 GCTACTTGGGAGATTGAGGCAGG + Intronic
1086511448 11:87562391-87562413 GCTACTTAGGAGTGGGAGGCAGG + Intergenic
1086893957 11:92290650-92290672 GCTACTCAGGAGATTGAGGCAGG + Intergenic
1087140533 11:94761298-94761320 GCTACTCAGGAGACGGAGGCAGG - Intronic
1087805203 11:102547961-102547983 GCTACTGAGGAGATTGAGGCAGG - Intergenic
1087924764 11:103906923-103906945 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1088194805 11:107262559-107262581 GAGACTTAGGGGATTGAGGATGG + Intergenic
1088225614 11:107616488-107616510 GTTACTCAGGAGATTGAGGCAGG - Intronic
1088261300 11:107946582-107946604 GCTACTTGGGAGATTGAGGCAGG - Intronic
1088274892 11:108074692-108074714 GCTACTTAGGAGACTGAGGCAGG + Intronic
1088328668 11:108628266-108628288 GTTACTCAGGAGATTGAGGCAGG - Intergenic
1088630774 11:111772019-111772041 CAGAGGTAGGAGATGGAGGAGGG - Intergenic
1088635129 11:111812453-111812475 GCTACTCAGGAGATTGAGGCAGG + Intronic
1089242250 11:117091892-117091914 GCTACTTGGGAGGTGGAGGCGGG - Intronic
1089336737 11:117730085-117730107 GCTACTTGGGAGGTGGAGGCAGG + Intronic
1089448695 11:118574876-118574898 GCTACTTGGGATATGGAGGCGGG - Intronic
1089912109 11:122111478-122111500 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1089949566 11:122512672-122512694 GTGACTTTGAAGATGGAGGAAGG - Intergenic
1089958218 11:122592397-122592419 GCTACTTGGGAGATGGAGGCAGG + Intergenic
1090068273 11:123522428-123522450 AAGACTTGGGAGACTGAGGCAGG - Intergenic
1090282441 11:125467726-125467748 GCTACTCAGGAGATGGAGGTGGG + Intronic
1090300598 11:125634432-125634454 GATACTGAGGAGACTGAGGCAGG - Intronic
1091049001 11:132351127-132351149 GCTACTCAGGAGACGGAGGCAGG + Intergenic
1091657978 12:2359767-2359789 GAGGGTTAGGACATGGAGACTGG + Intronic
1091716223 12:2778299-2778321 GCTACTTGGGAGATTGAGGCAGG - Intergenic
1091734213 12:2906140-2906162 GCTACTTAGGAGACTGAGGCAGG - Intronic
1091782322 12:3221765-3221787 GCTACTTAGGAGACTGAGGCAGG - Intronic
1092139580 12:6173737-6173759 GAGCCTTCTGAGAGGGAGGCAGG - Intergenic
1092259149 12:6943189-6943211 GCGACTTGGGAGGTTGAGGCAGG + Intronic
1092379602 12:7984566-7984588 GAGACTTGGGAGGTTGAGACAGG + Intergenic
1092458223 12:8663853-8663875 GCGACTTAGGAGGCTGAGGCAGG - Intergenic
1092556129 12:9563821-9563843 GCTACTCAGAAGATGGAGGCAGG + Intergenic
1092651041 12:10635230-10635252 GAGACTCAGGGGATTGAGGCAGG - Intronic
1092818238 12:12329770-12329792 GATACTTAGGAGGCTGAGGCAGG + Exonic
1092825096 12:12391495-12391517 GCGACTTGGGAGACTGAGGCAGG - Intronic
1092888063 12:12942621-12942643 GCTACTTGGGAGGTGGAGGCAGG + Intronic
1093189175 12:16055540-16055562 GCTACTTAGGAGGTGGAGGCAGG + Intergenic
1093295804 12:17389884-17389906 GCTACTCAGGAGATTGAGGCAGG + Intergenic
1093472151 12:19513649-19513671 GATACTCAGGAGACTGAGGCGGG + Intronic
1093615607 12:21219871-21219893 GCTACTTAGGAGGTTGAGGCAGG - Intronic
1093770808 12:23015511-23015533 GAGATTTAGGAGACTGAGGCAGG - Intergenic
1094001220 12:25696741-25696763 GAGTCTTATAATATGGAGGCAGG - Intergenic
1094017326 12:25879216-25879238 GCTACTCAGGAGACGGAGGCAGG - Intergenic
1094215776 12:27940462-27940484 GCTACTCAGCAGATGGAGGCAGG - Intergenic
1094540982 12:31363047-31363069 AAGACTGAGGAGATGGAGGGAGG + Intergenic
1095111779 12:38302821-38302843 GAGTCTTAGAAAATGGAGGAAGG - Intergenic
1095322560 12:40846977-40846999 GCTACTCAGGAGGTGGAGGCAGG - Intronic
1095343009 12:41114395-41114417 GATACTTAGGAGGCAGAGGCTGG + Intergenic
1095436513 12:42194530-42194552 GCTACTTAGGAGGTGGAGGCAGG + Intronic
1095447650 12:42298167-42298189 GAACTTTGGGAGATGGAGGCAGG - Intronic
1095967980 12:47882400-47882422 GAGAAAGAGGAGATGGGGGCTGG + Intronic
1096118893 12:49073489-49073511 GCTACTCAGGAGACGGAGGCAGG + Intergenic
1096151591 12:49316898-49316920 GAGACTTAGGAAGCTGAGGCAGG + Intergenic
1096252917 12:50044796-50044818 TAGAGGTAGGAGATGGAGGCCGG - Intergenic
1096338355 12:50775189-50775211 GCTACTTAGGAGGTTGAGGCAGG - Intronic
1096384783 12:51188037-51188059 GCTACTTGGGAGGTGGAGGCAGG - Exonic
1096388152 12:51208823-51208845 GCTACTCAGGAGATTGAGGCAGG + Intronic
1096704411 12:53409896-53409918 GCTACTCAGGAGGTGGAGGCAGG + Intronic
1096754037 12:53783970-53783992 GAGACTTGGGAGGCTGAGGCAGG + Intergenic
1096816033 12:54202360-54202382 GCTACTTAGGAGGTAGAGGCAGG + Intergenic
1096909643 12:54970036-54970058 GCTACTCAGGAGATTGAGGCAGG - Intronic
1097028934 12:56078205-56078227 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1097288342 12:57894555-57894577 GAGGGTTAGAAGGTGGAGGCTGG + Intergenic
1097350326 12:58541977-58541999 GTGACTCAGGAGACTGAGGCTGG + Intergenic
1097635744 12:62119959-62119981 GCTACTCAGGAGATTGAGGCAGG + Intronic
1097893959 12:64805719-64805741 GCTACTTGGGAGGTGGAGGCAGG + Intronic
1097930572 12:65180054-65180076 GATACTTGGGAGGTGGAGGCAGG - Intronic
1098104688 12:67056920-67056942 GCTACTTGGGAGATTGAGGCAGG - Intergenic
1098336759 12:69412539-69412561 GATACTCAGGAGGTTGAGGCAGG + Intergenic
1098543705 12:71687443-71687465 GCTACTTGGGAGATGGAGGCAGG + Intronic
1098826464 12:75303891-75303913 AAGACTTTGAAGATGGAGGAAGG + Intronic
1098953367 12:76664374-76664396 GCTACTTGGGAGATTGAGGCAGG + Intergenic
1099209070 12:79762795-79762817 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1099447489 12:82769362-82769384 GAGACTCAGGAGGCTGAGGCAGG + Intronic
1100171180 12:91976735-91976757 GATACTTAGGAGGCTGAGGCAGG + Intergenic
1100254986 12:92874207-92874229 GGTACTTAGGAGGTTGAGGCGGG + Intronic
1100324420 12:93527603-93527625 GCTACTTGGGAGATGGAGGGGGG + Intergenic
1100370437 12:93964552-93964574 TAGAATTAGGAGCTGGGGGCCGG + Intergenic
1100419920 12:94423194-94423216 GCTACTTGGGAGGTGGAGGCAGG - Intronic
1100618002 12:96246547-96246569 GCCACTCAGGAGGTGGAGGCAGG + Intronic
1100627409 12:96349339-96349361 GCTACTTAGGAGGTTGAGGCGGG + Intronic
1100718295 12:97328689-97328711 GAGAATTAGGAGGTGCGGGCAGG + Intergenic
1100826135 12:98476356-98476378 GCTACTCAGGAGATTGAGGCAGG + Intergenic
1100930479 12:99603151-99603173 GCTACTTAGGAGACTGAGGCAGG - Intronic
1100964528 12:99998393-99998415 GATACTTGGGAGATGGAGGTGGG + Intergenic
1100973440 12:100096141-100096163 GCTACTTGGGAGGTGGAGGCAGG + Intronic
1101062232 12:100984206-100984228 GCTACTTAGGAGGTTGAGGCAGG - Intronic
1101349701 12:103917577-103917599 GCTACTTAGGAGGTTGAGGCAGG + Intergenic
1101615075 12:106328430-106328452 GCTACTTAGGAGACTGAGGCAGG + Intronic
1101858856 12:108466216-108466238 GCTACTTAGGAGGTGGAGGCAGG - Intergenic
1101914993 12:108889215-108889237 GATACTCAGGAGATTGAGGCAGG - Intronic
1101994215 12:109513131-109513153 GAGGCCCAGGAGATGAAGGCTGG - Intronic
1102093181 12:110211323-110211345 GCTACTTGGGAGGTGGAGGCAGG + Intronic
1102093850 12:110219312-110219334 GCTACTTGGGAGGTGGAGGCAGG - Intergenic
1102126921 12:110490652-110490674 GCTACTTGGGAGATTGAGGCAGG + Intergenic
1102155833 12:110727047-110727069 GACACTCAGGAGATTGAGGCAGG - Intronic
1102240420 12:111321355-111321377 GCTACTTAGGAGACTGAGGCAGG + Intronic
1102445772 12:113001714-113001736 GGTACTTATAAGATGGAGGCAGG - Intronic
1102613555 12:114133560-114133582 GCTACTTAGGAGGTTGAGGCAGG - Intergenic
1102624919 12:114227209-114227231 GCTACTTAGGAGGTTGAGGCAGG + Intergenic
1102847598 12:116203706-116203728 GCTACTCAGGAGATTGAGGCAGG + Intronic
1103044225 12:117722118-117722140 GCTACTTAGGAGAACGAGGCGGG - Intronic
1103063444 12:117877223-117877245 GCTACTTGGGAGATTGAGGCAGG + Intronic
1103092606 12:118108044-118108066 GCTACTTGGGAGACGGAGGCAGG - Intronic
1103214096 12:119188356-119188378 GCTACTTGGGAGATTGAGGCCGG - Intronic
1103306203 12:119966236-119966258 GCTACTTGGGAGATTGAGGCAGG - Intergenic
1103352423 12:120294113-120294135 GCTACTTGAGAGATGGAGGCAGG - Intergenic
1103366900 12:120390107-120390129 GCTACTTAGGAGACTGAGGCAGG + Intergenic
1103767115 12:123288112-123288134 GATACTTGGGAGGCGGAGGCAGG + Intergenic
1104177483 12:126347080-126347102 GCTACTTAGGAGACTGAGGCAGG + Intergenic
1104994999 12:132648831-132648853 GGTACTGAGGAGATGGAGGCTGG + Intronic
1105312606 13:19226285-19226307 GCTACTTAGGAGACTGAGGCAGG + Intergenic
1105339551 13:19507493-19507515 TGGACTTTGGAGATGGAGGCAGG - Intronic
1105364157 13:19749234-19749256 GCCACTTAGGAGGCGGAGGCAGG + Intronic
1105491454 13:20892447-20892469 GAGACTAGGGAAATAGAGGCTGG - Intronic
1105700132 13:22929562-22929584 GTGACTCAGGAGGTTGAGGCAGG - Intergenic
1105926890 13:25016942-25016964 GCTACTTGGGAGATTGAGGCAGG + Intergenic
1106035334 13:26039058-26039080 GCTACTTAGGAGACTGAGGCAGG + Intergenic
1106044045 13:26121111-26121133 GATACTTGGGAGACTGAGGCAGG - Intergenic
1106335271 13:28777974-28777996 GAGGCTCAGGAGAAGGTGGCAGG + Intergenic
1106391462 13:29339037-29339059 GAGGCTCAGGAGAAGGTGGCAGG + Intronic
1106626904 13:31430129-31430151 GCTACTTGGGAGATCGAGGCAGG - Intergenic
1106662899 13:31820460-31820482 GCTACTCAGGAGACGGAGGCAGG + Intergenic
1106679978 13:31999494-31999516 GAGACTGGGGAGAGGGAGACTGG - Intergenic
1106726248 13:32488959-32488981 GCTACTCAGGAGATGGACGCAGG + Intronic
1106752792 13:32792159-32792181 GCTACTTGGGAGATGGAGGTGGG - Intergenic
1106774012 13:32991124-32991146 GATAGTTAGGTGATGGAGCCAGG + Intergenic
1106820486 13:33458930-33458952 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1107174917 13:37388772-37388794 GATACTTAGGAGGCTGAGGCAGG + Intergenic
1107510687 13:41081083-41081105 GCTACTCAGGAGGTGGAGGCAGG + Intronic
1107511288 13:41088082-41088104 GTTACTTAGGAGGTGGAGGGAGG - Intergenic
1107642704 13:42460235-42460257 AAGGCTTAGGAGATAGATGCAGG - Intergenic
1107966526 13:45603033-45603055 GAGGCTTAAGACATGGAGGAGGG + Intronic
1108217397 13:48198876-48198898 GCGACTTGGGAGACTGAGGCAGG + Intergenic
1108456089 13:50615111-50615133 GCTACTTGGGAGATGGAGGCAGG + Intronic
1108687900 13:52836754-52836776 GAGACTCAGGAGGCTGAGGCAGG - Intergenic
1108738995 13:53315146-53315168 GAGACTCAGAAGAGGGAGGGTGG + Intergenic
1108883369 13:55148535-55148557 GCTACTTAGGAGACTGAGGCAGG + Intergenic
1109023439 13:57129503-57129525 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
1109291329 13:60478913-60478935 GCTACTTAGGAGACTGAGGCAGG - Intronic
1109411719 13:61979058-61979080 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1110201659 13:72857726-72857748 GCTACTTGGGAGGTGGAGGCAGG + Intronic
1110211015 13:72973158-72973180 GATACTTAGGAGACTGAAGCAGG + Intronic
1110286716 13:73758144-73758166 GAGACTTGAGAGACTGAGGCAGG - Intronic
1110305376 13:73981046-73981068 GCTACTTGGGATATGGAGGCAGG + Intronic
1110544087 13:76737221-76737243 GCTACTTGGGAGGTGGAGGCAGG - Intergenic
1110592133 13:77275575-77275597 GCTACTTGGGAGGTGGAGGCAGG + Intronic
1110850318 13:80238128-80238150 GCGACTTGGGAGGTTGAGGCAGG - Intergenic
1111368227 13:87279100-87279122 GTCACTTGGGAGATGGAGGCAGG - Intergenic
1111534837 13:89589649-89589671 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1111827986 13:93293092-93293114 GCTACTTGGGAGATGGAGGTGGG - Intronic
1111908944 13:94288421-94288443 GAGACTGGGGACATGGAGGGAGG - Intronic
1112062114 13:95751121-95751143 GCTACTTGGGAGGTGGAGGCAGG + Intronic
1112277776 13:98036850-98036872 GCGACTTAGGAGGCTGAGGCAGG + Intergenic
1112542415 13:100328249-100328271 GCTACTTAGGAGACTGAGGCAGG + Intronic
1112582030 13:100684727-100684749 GATACTCAGGAGGCGGAGGCAGG + Intergenic
1112634782 13:101203325-101203347 GCTACTTAGGAGACTGAGGCAGG - Intronic
1112669370 13:101616600-101616622 GCTACTTAGGAGACTGAGGCAGG - Intronic
1113116073 13:106875996-106876018 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
1113435613 13:110288918-110288940 GCTACTCAGGAGGTGGAGGCAGG + Intronic
1113815285 13:113165640-113165662 GCTACTCAGGAGGTGGAGGCAGG - Intronic
1113855283 13:113441039-113441061 GCTACTTGGGAGGTGGAGGCAGG + Intronic
1113983894 13:114298426-114298448 GCTACTCAGGAGGTGGAGGCAGG + Intronic
1114032784 14:18590399-18590421 GCTACTCAGGAGACGGAGGCAGG + Intergenic
1114081593 14:19205441-19205463 GCTACTTGGGAGGTGGAGGCAGG - Intergenic
1114175137 14:20311495-20311517 GCTACTTAGGAGGTTGAGGCTGG - Exonic
1114385622 14:22251448-22251470 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1114470384 14:22957130-22957152 GCGACGAAGGAGGTGGAGGCGGG + Exonic
1114509746 14:23248551-23248573 GCTACTCAGGAGGTGGAGGCAGG - Intronic
1115178590 14:30595024-30595046 GCTACTTAGGAGGCGGAGGCAGG + Intronic
1115211480 14:30971033-30971055 TAGTGTTGGGAGATGGAGGCTGG - Intronic
1115249006 14:31327084-31327106 GCTACTTAGGAGACTGAGGCAGG - Intronic
1115252821 14:31367509-31367531 GCTACTCAGGAGGTGGAGGCAGG - Intronic
1115517203 14:34197854-34197876 GAGACTGAGGAGATGGTTTCAGG + Intronic
1115599640 14:34943083-34943105 GATACTCGGGAGATTGAGGCAGG + Intergenic
1115632737 14:35261615-35261637 GCTACTCAGGAGATTGAGGCAGG + Intronic
1115808264 14:37076598-37076620 GCTACTTAGGAGACTGAGGCAGG - Intronic
1115988635 14:39128600-39128622 GCTACTCAGGAGATTGAGGCAGG - Intronic
1116649897 14:47576858-47576880 GATACTTAGGAGGCTGAGGCAGG - Intronic
1116712162 14:48382733-48382755 GATACTTGGGAGACTGAGGCAGG + Intergenic
1116791926 14:49348363-49348385 GCTACTCAGGAGATTGAGGCAGG + Intergenic
1116807997 14:49511948-49511970 GATACTTGGGAGATTGAGGCAGG + Intergenic
1116851587 14:49914368-49914390 GATACTCAGGAGACTGAGGCAGG - Intergenic
1117022581 14:51586853-51586875 GCTACTTAGGAGATGGAGGCGGG - Intronic
1117041066 14:51769492-51769514 GCTGCTCAGGAGATGGAGGCAGG + Intergenic
1117499440 14:56337644-56337666 GCTACTTAGGAGCTTGAGGCGGG - Intergenic
1117637752 14:57764031-57764053 GCGTCTCAGGAAATGGAGGCTGG - Intronic
1117674710 14:58143883-58143905 GCTACTTAGGAAATTGAGGCAGG - Intronic
1117740574 14:58815269-58815291 AGGACTCAGGAGATGGAGGCAGG - Intergenic
1117904630 14:60571819-60571841 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
1117950562 14:61079246-61079268 GCTACTCAGGAGGTGGAGGCAGG - Intronic
1117950875 14:61081571-61081593 GCTACTCAGGAGGTGGAGGCAGG + Intronic
1117952680 14:61098516-61098538 GCTACTTGGGAGGTGGAGGCAGG - Intergenic
1118212804 14:63781164-63781186 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
1118306619 14:64660420-64660442 GAGAGTAAGGAGGTGGATGCAGG - Intergenic
1118394537 14:65324548-65324570 GCTACTCAGGAGATCGAGGCAGG + Intergenic
1118556710 14:67031689-67031711 GCTACTCAGGAGATTGAGGCAGG - Intronic
1118602915 14:67482872-67482894 GTGACTTGGGAGGTGGAGGGAGG - Intronic
1118630722 14:67700026-67700048 GCTCCTTGGGAGATGGAGGCAGG + Intergenic
1118644502 14:67824367-67824389 GCTACTCAGGAGATGGAAGCAGG - Intronic
1118647606 14:67854852-67854874 GCTACTTAGGAGACTGAGGCAGG + Intronic
1118767124 14:68917290-68917312 GAGCCTTGGGAAATGGAGCCGGG - Intronic
1118934960 14:70279354-70279376 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
1119294798 14:73524178-73524200 GCTACTTGGGAGATTGAGGCAGG + Intronic
1119398078 14:74343236-74343258 GCTACTCAGGAGATTGAGGCAGG - Intronic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119473013 14:74910981-74911003 GCTACTTGGGAGGTGGAGGCAGG - Intronic
1119888345 14:78163512-78163534 GGGCCTTAGGAGATGGAGCAGGG + Intergenic
1120078852 14:80191634-80191656 GAAACTTGGGAGACTGAGGCAGG + Intergenic
1120410097 14:84143570-84143592 GATACTTGGGAGACTGAGGCAGG - Intergenic
1120443893 14:84569291-84569313 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1120452127 14:84681502-84681524 GCTACTCAGGAGATTGAGGCAGG + Intergenic
1120571561 14:86124138-86124160 GAGACTGAAGAGACAGAGGCTGG + Intergenic
1120750908 14:88197459-88197481 GCTACTTAGGAGACTGAGGCAGG + Intronic
1120767370 14:88341753-88341775 GATACTTAGGAGGCTGAGGCAGG - Intergenic
1120809926 14:88792818-88792840 GCGGCTGAGGAGCTGGAGGCGGG - Intergenic
1121108238 14:91294764-91294786 GAGACTCAGGAGGCTGAGGCAGG - Intronic
1121770298 14:96529608-96529630 GCTACTTAGGAGACTGAGGCAGG + Intronic
1121882767 14:97515311-97515333 GAGACATCAGAGATGGAGGGTGG - Intergenic
1122180360 14:99950093-99950115 GATACTTGGGAGGTTGAGGCAGG + Intergenic
1122220528 14:100236461-100236483 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1122403971 14:101487716-101487738 GATACTTAGGAGGTTGAGGTGGG - Intergenic
1122427859 14:101622169-101622191 GATACTTAGGAGGCTGAGGCAGG + Intergenic
1122490591 14:102113133-102113155 GCTACTTGGGAGATTGAGGCAGG - Intronic
1122518376 14:102324836-102324858 GATACTTGGGAGACTGAGGCAGG + Intronic
1122628649 14:103097460-103097482 GAGCCTTGGGAGGTGGAGGGGGG + Intergenic
1122911993 14:104834692-104834714 GCTACTTGGGAGATTGAGGCAGG + Intergenic
1202841489 14_GL000009v2_random:125264-125286 GATACTCAGGAGGTTGAGGCAGG - Intergenic
1202910877 14_GL000194v1_random:115496-115518 GATACTCAGGAGGTTGAGGCAGG - Intergenic
1123668390 15:22628586-22628608 GAGACTTTGGAGAGTGAGGGAGG - Intergenic
1123807836 15:23893582-23893604 GATACTCAGGAGACTGAGGCAGG - Intergenic
1123900404 15:24871127-24871149 GAGACTTGGGAGACCGAGGTGGG - Intronic
1124356814 15:29001552-29001574 GAGACTCATGAGTTGGGGGCGGG + Intronic
1124473791 15:30012607-30012629 GCTACTGAGGAGATTGAGGCAGG + Intergenic
1124479403 15:30064819-30064841 GCTACTTAGGAGGTGGAGGCAGG - Intergenic
1124524367 15:30435047-30435069 GAGACTTTGGAGAGTGAGGGAGG - Intergenic
1124534298 15:30531176-30531198 GAGACTTTGGAGAGTGAGGGAGG + Intergenic
1124567214 15:30827269-30827291 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1124659385 15:31533346-31533368 GCTACTTAGGAGGTTGAGGCAGG - Intronic
1124764350 15:32476435-32476457 GAGACTTTGGAGAGTGAGGGAGG - Intergenic
1124774284 15:32572663-32572685 GAGACTTTGGAGAGTGAGGGAGG + Intergenic
1124914960 15:33961245-33961267 GAGATTTAGGAGGCTGAGGCAGG - Intronic
1125126964 15:36235568-36235590 GCTACTCAGGAGATTGAGGCCGG + Intergenic
1125294178 15:38184489-38184511 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
1125558732 15:40609301-40609323 GATACTTAGGAGGCTGAGGCTGG + Intronic
1125570305 15:40711958-40711980 GCTACTTGGGAGGTGGAGGCGGG + Intronic
1125613553 15:40989724-40989746 GAGAGTTTGGACATGGTGGCAGG - Intronic
1125634067 15:41172505-41172527 GTTACTTGGGAGATTGAGGCAGG + Intergenic
1125650408 15:41312569-41312591 GCTACTTAGGAGACTGAGGCAGG - Intronic
1125977606 15:43969191-43969213 GCTACTCAGGAGATTGAGGCAGG - Intronic
1126013390 15:44325828-44325850 GTATCTTAGGAGATGGAGACAGG + Intronic
1126033133 15:44520256-44520278 GCTACTAAGGAGGTGGAGGCAGG - Intronic
1126405713 15:48320618-48320640 GAGACTAAGAAGCTGGAGGCTGG - Intergenic
1126409406 15:48356526-48356548 GGGACTCAGGAGTTGGTGGCAGG + Intergenic
1126571202 15:50153448-50153470 GCTACTCAGGAGATGGAGGCAGG - Intronic
1126585625 15:50282941-50282963 GCTACTTAGGAGACTGAGGCAGG + Intronic
1126591718 15:50346899-50346921 GCTACTCAGGAGGTGGAGGCAGG - Intronic
1126647143 15:50885745-50885767 GCTACTTGGGAGGTGGAGGCAGG + Intergenic
1126715863 15:51516792-51516814 GAGACTCAGAAGAGGGAGGGTGG - Intronic
1126766392 15:52015587-52015609 GCTACTTAGGAGGTTGAGGCAGG - Intronic
1126794791 15:52251774-52251796 GCTACTTAGGAGACTGAGGCAGG - Intronic
1126931892 15:53662816-53662838 GAGACTCAGGAGGCTGAGGCAGG + Intronic
1126991479 15:54382340-54382362 GAGACTTGGGAGGCAGAGGCAGG + Intronic
1127449525 15:59103274-59103296 GAGACTCAGAAGAGGGAGGGTGG - Intergenic
1127887593 15:63216338-63216360 GATACTTGGGAGGTTGAGGCAGG - Intronic
1127915578 15:63452272-63452294 CAGATTTAGGAGATGGGTGCTGG + Intergenic
1127988047 15:64090229-64090251 GCTACTTAGGAGACTGAGGCAGG + Intronic
1128078225 15:64841597-64841619 GAGACTGAGGCGAGGGTGGCGGG - Intergenic
1128086459 15:64889921-64889943 GCTACTTAGGAGGTTGAGGCAGG + Intronic
1128142816 15:65314213-65314235 GCGACTTGGGAGACTGAGGCGGG + Intergenic
1128269691 15:66298065-66298087 GCTACTCAGGAGACGGAGGCAGG + Intronic
1128457783 15:67842305-67842327 GCTACTTGGGAGGTGGAGGCAGG - Intergenic
1128478306 15:68016158-68016180 GCACTTTAGGAGATGGAGGCAGG + Intergenic
1128571709 15:68738441-68738463 GCTACTTGGGAGGTGGAGGCAGG - Intergenic
1128852653 15:70975579-70975601 GAGACTTGGGGGACTGAGGCAGG + Intronic
1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG + Intergenic
1130126243 15:81096451-81096473 GCTACTCAGGAGGTGGAGGCAGG + Intronic
1130137251 15:81191696-81191718 CCCACTTAGGAGATGGAGTCAGG + Intronic
1130239988 15:82179030-82179052 GCTACTTAGGAGACTGAGGCAGG + Intronic
1130383912 15:83394714-83394736 GCCACTTGGGAGATTGAGGCAGG + Intergenic
1130521729 15:84667036-84667058 GCTACTTGGGAGGTGGAGGCAGG - Intergenic
1130585526 15:85178089-85178111 GCTACTCAGGAGATGGAGGTGGG - Intergenic
1130717961 15:86354950-86354972 TGGACTTTGAAGATGGAGGCAGG + Intronic
1130853750 15:87822562-87822584 GCTACTCAGGAGATCGAGGCAGG + Intergenic
1131038433 15:89241263-89241285 GCTACTTAGGAGGTTGAGGCAGG - Intergenic
1131130321 15:89894861-89894883 GATACTTGGGAGACTGAGGCAGG + Intronic
1131208758 15:90474919-90474941 GATACTTAGGAGGTTGAGGGAGG - Intronic
1131302269 15:91210113-91210135 GATAATTAGGAGATGGAGATAGG + Intronic
1131349720 15:91687967-91687989 GAGACTTGGGAGGCTGAGGCAGG + Intergenic
1131355950 15:91746936-91746958 GCTACTTAGGAGACTGAGGCAGG + Intergenic
1131627898 15:94143194-94143216 GATACTCAGGAGGTTGAGGCAGG + Intergenic
1131717963 15:95133896-95133918 GCGACTTTGGAGACTGAGGCAGG + Intergenic
1131794275 15:95998519-95998541 GATACTCAGGAGGTTGAGGCAGG + Intergenic
1131835297 15:96384236-96384258 GCTACTTAGGAGGTTGAGGCAGG - Intergenic
1132472213 16:111526-111548 GAGCCTTGGGAGGTGGAGGTTGG - Intronic
1133035769 16:3033336-3033358 GGGACTCAGGAGAAGGTGGCTGG + Intronic
1133158591 16:3893409-3893431 GCTACTTAGGAGACTGAGGCAGG + Intergenic
1133746171 16:8688359-8688381 GAGACTTAGGTTTTGGAGCCAGG - Intronic
1133961003 16:10493333-10493355 TAGTGTTGGGAGATGGAGGCTGG - Intergenic
1134113852 16:11533494-11533516 GCTACTTGGGAGATTGAGGCAGG + Intergenic
1134171916 16:11976106-11976128 GAGATTGAGGAGGTGGAGGGAGG - Intronic
1134191625 16:12125751-12125773 TAGCCTTAAGAGATGTAGGCCGG - Intronic
1134228448 16:12410555-12410577 GATACTTAGGAGGCTGAGGCAGG - Intronic
1134469964 16:14515220-14515242 GCTACTCAGGAGATTGAGGCAGG - Intronic
1134589640 16:15442032-15442054 AAGACTTAGGAGAGGGAGGCCGG + Intronic
1134594206 16:15482474-15482496 GAGACTTTGGAGGAGGAGCCTGG + Intronic
1134628967 16:15743278-15743300 GCTACTCAGGAGATTGAGGCAGG - Intronic
1134653811 16:15931434-15931456 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
1134655299 16:15943771-15943793 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
1134682100 16:16133513-16133535 GATACTCGGGAGACGGAGGCAGG - Intronic
1134764517 16:16744956-16744978 GCTACTTGGGAGATTGAGGCAGG - Intergenic
1134808001 16:17142013-17142035 GCTACTCAGGAGCTGGAGGCAGG - Intronic
1134981535 16:18614257-18614279 GCTACTTGGGAGATTGAGGCAGG + Intergenic
1135096354 16:19567856-19567878 GCTACTCAGGAGACGGAGGCAGG + Intronic
1135275717 16:21110757-21110779 CAGACTTAGGAGGTTGAGGCAGG + Intronic
1135392781 16:22107632-22107654 GCTACTTAGGAGATTGAGGCAGG + Intronic
1135406387 16:22201076-22201098 GATACTTGGGAGGTTGAGGCGGG + Intergenic
1135599158 16:23767195-23767217 GCTACTTAGGAGACTGAGGCAGG + Intergenic
1135749212 16:25043443-25043465 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
1135973014 16:27086008-27086030 GAGACTCAGAAGGTGGAGGGTGG + Intergenic
1136020290 16:27435878-27435900 GATACTTGGGAGGTTGAGGCAGG - Intronic
1136342508 16:29654235-29654257 GCTACTTAGGAGACCGAGGCAGG - Intergenic
1136350884 16:29706838-29706860 GCTACTCGGGAGATGGAGGCAGG - Intergenic
1136354840 16:29737643-29737665 GAGACTTGGGAGGCTGAGGCAGG + Intergenic
1136377492 16:29873860-29873882 GCTACTCAGGAGTTGGAGGCGGG + Intronic
1136389767 16:29956235-29956257 GCTACTTAGGAGGTTGAGGCAGG + Intronic
1136506608 16:30708318-30708340 GATACTTGGGAGATCGAGGCAGG - Intronic
1136603303 16:31312536-31312558 GACACTTAGGAGGCTGAGGCAGG - Intronic
1136623263 16:31443860-31443882 GCTACTTAGGAGACTGAGGCAGG + Intergenic
1136651102 16:31672073-31672095 GAGACTTAGAAGGGGGAGGGTGG - Intergenic
1136725947 16:32357636-32357658 GACACTCAGGAGACTGAGGCAGG + Intergenic
1136844280 16:33563687-33563709 GATACTCAGGAGACTGAGGCAGG + Intergenic
1137489791 16:48922691-48922713 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
1137602889 16:49768602-49768624 GAGACTGAGGAGATGGAGAAAGG - Intronic
1137654774 16:50150936-50150958 GCTACTTAGGAGGTTGAGGCAGG - Intergenic
1137677341 16:50310228-50310250 GAGAACTGGGAGATGGAGCCGGG + Intronic
1137684250 16:50374780-50374802 GAGACTGAGGAGGGGGAGGGAGG + Intergenic
1137777630 16:51069847-51069869 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
1138243445 16:55447327-55447349 GAGACATAGGAAATGGGGGAAGG - Intronic
1138479826 16:57294887-57294909 GATACTCAGGAGACTGAGGCAGG + Intergenic
1138852015 16:60641009-60641031 GAGATGTAGGAGATGGAGATAGG + Intergenic
1138918438 16:61496908-61496930 GCTACTTGGGAGGTGGAGGCAGG + Intergenic
1138990636 16:62387019-62387041 GCTACTTAGGAGGTTGAGGCAGG - Intergenic
1139052676 16:63145377-63145399 GAGACTTGGGAGACTGAGGCAGG - Intergenic
1139134507 16:64185559-64185581 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
1139152889 16:64405978-64406000 GATACTCAGGAGACTGAGGCAGG - Intergenic
1139256336 16:65546533-65546555 CAGAATTAAGAGATGGGGGCAGG - Intergenic
1139356508 16:66370110-66370132 GCTACTTGGGAGATTGAGGCAGG - Intronic
1139411248 16:66762494-66762516 GCTACTTAGGAGACTGAGGCTGG - Intronic
1139524764 16:67508355-67508377 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1139646290 16:68333367-68333389 GCTACTGAGGAGATTGAGGCAGG + Intronic
1139714569 16:68802580-68802602 GCTACTCAGGAGGTGGAGGCAGG - Intronic
1139900051 16:70321072-70321094 GCTACTTGGGAGGTGGAGGCAGG - Intronic
1139905185 16:70360430-70360452 GCTACTTGGGAGATTGAGGCAGG - Intronic
1140078823 16:71725173-71725195 GCCACTTGGGAGGTGGAGGCAGG + Intergenic
1140085381 16:71791571-71791593 GCTACTCAGGAGATTGAGGCAGG + Intronic
1140316148 16:73899507-73899529 GCTACTTGGGAGATTGAGGCAGG + Intergenic
1140357980 16:74321963-74321985 GCTACTTGGGAGGTGGAGGCAGG + Intergenic
1140534664 16:75698781-75698803 GCTACTTAGGAGGTTGAGGCAGG - Intronic
1140843648 16:78865766-78865788 GCTACTCAGGAGACGGAGGCAGG + Intronic
1141144239 16:81517841-81517863 GAGGCTTGGGAGATGCAGCCAGG + Intronic
1141382681 16:83589930-83589952 GGGGCTTAGGAGGTGGGGGCGGG + Intronic
1141425151 16:83940055-83940077 GCTACTTGGGAGGTGGAGGCAGG + Intronic
1141448959 16:84084069-84084091 GCTACTCAGGAGATTGAGGCAGG - Intronic
1141478227 16:84288224-84288246 GTGGCTTTGGAGATGGAGGAAGG - Intergenic
1141514345 16:84533662-84533684 GCTACTTGGGAGGTGGAGGCAGG - Intronic
1142096202 16:88241245-88241267 GCTACTTAGGAGGTTGAGGCAGG + Intergenic
1142212077 16:88813110-88813132 GAGCCTTCGGAGGGGGAGGCCGG + Intergenic
1203000484 16_KI270728v1_random:160119-160141 GACACTCAGGAGACTGAGGCAGG - Intergenic
1203132086 16_KI270728v1_random:1696523-1696545 GACACTCAGGAGACTGAGGCAGG - Intergenic
1203154446 16_KI270728v1_random:1863986-1864008 GATACTCAGGAGACTGAGGCAGG + Intergenic
1142539906 17:650383-650405 GCTACTCAGGAGGTGGAGGCAGG + Intronic
1142578795 17:927491-927513 GCTACTTAGGAGGTTGAGGCAGG + Intronic
1142633821 17:1244035-1244057 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1142679366 17:1537173-1537195 GCTACTTAGGAGACTGAGGCAGG - Intronic
1142869880 17:2813182-2813204 GCTACTCAGGAGACGGAGGCAGG - Intronic
1142994602 17:3753216-3753238 GACACAGAGGTGATGGAGGCTGG - Intronic
1143313989 17:6017491-6017513 GACACCTAGAAGATGGATGCTGG - Intronic
1143370143 17:6434468-6434490 GATACTCAGGAGACTGAGGCAGG - Intronic
1143450607 17:7034656-7034678 GAAACTCAGGAGACTGAGGCAGG + Intergenic
1143477047 17:7208747-7208769 GAGACTGAGGCCATGGAGGTGGG - Intronic
1143820285 17:9555782-9555804 GCTACTTGGGAGGTGGAGGCAGG + Intronic
1144062864 17:11598971-11598993 GAGCCTTAAGGGACGGAGGCGGG + Intronic
1144358001 17:14464057-14464079 GCTACTCAGGAGACGGAGGCAGG - Intergenic
1144395205 17:14836617-14836639 GAGCCTTATAAGAGGGAGGCAGG + Intergenic
1144528598 17:16013090-16013112 GCTACTTAGGAGACTGAGGCAGG + Intronic
1144700506 17:17335367-17335389 GCTACTTGGGAGGTGGAGGCAGG - Intronic
1144729149 17:17516816-17516838 GACACTTAGGACAGGGAAGCTGG - Intronic
1144804475 17:17955448-17955470 GCTACGTGGGAGATGGAGGCTGG - Intronic
1144825206 17:18101896-18101918 GAGATTGAGAAGGTGGAGGCCGG - Intronic
1144920178 17:18757293-18757315 GCTACTTAGGAGACTGAGGCAGG - Intronic
1145078668 17:19876332-19876354 GCTACTTAGGAGACTGAGGCAGG + Intergenic
1145387604 17:22427414-22427436 AAGACTTGGGAGGTTGAGGCAGG - Intergenic
1145860026 17:28201902-28201924 GACACTTAGGAGGCTGAGGCAGG + Intergenic
1145953402 17:28837762-28837784 GTTACTTAGGAGACTGAGGCGGG - Intronic
1145988514 17:29063683-29063705 GATACTTAGGAGGCTGAGGCAGG + Intergenic
1146041054 17:29455020-29455042 GCAACTTAGGAGACTGAGGCAGG - Intronic
1146143033 17:30386139-30386161 GCTACTCAGGAGATTGAGGCAGG - Intronic
1146316002 17:31807331-31807353 GATACTTAGGAGGCTGAGGCAGG - Intergenic
1146695978 17:34909450-34909472 GTCACTTATGAGATGGGGGCTGG - Intergenic
1146715573 17:35084125-35084147 GCTACTTGGGAGACGGAGGCAGG + Intronic
1146763774 17:35500615-35500637 GATACTCAGGAGACTGAGGCAGG + Intronic
1146792261 17:35758578-35758600 GCTACTCAGGAGATTGAGGCAGG + Intronic
1146953270 17:36921127-36921149 GAAACTTTGGGGATGGAGACAGG - Intergenic
1147032032 17:37646297-37646319 GAGAATTATGAGATGGGGGTGGG + Intergenic
1147170344 17:38614828-38614850 GCTACTTAGGAGGTTGAGGCAGG + Intergenic
1147273159 17:39291543-39291565 GATACTTGGGAGACTGAGGCAGG - Intronic
1147369010 17:39978894-39978916 GCTACTCAGGAGAAGGAGGCAGG + Intergenic
1147548397 17:41420845-41420867 CCGAGTTAGGAGATTGAGGCTGG - Exonic
1147576722 17:41605567-41605589 GCTACTCAGGAGATTGAGGCAGG + Intergenic
1147630914 17:41931003-41931025 GCTACTTGGGAGGTGGAGGCAGG - Intronic
1148181603 17:45609756-45609778 GTGACTTAGGAGGCTGAGGCAGG - Intergenic
1148224502 17:45889304-45889326 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
1148267248 17:46235937-46235959 GTGACTTAGGAGGCTGAGGCAGG + Intergenic
1148392402 17:47282058-47282080 GCTACTTGGGAGACGGAGGCAGG - Intronic
1148654496 17:49273115-49273137 GCTACTCAGGAGACGGAGGCAGG - Intergenic
1148659715 17:49319519-49319541 GCTACTCAGGAGACGGAGGCAGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148722407 17:49763636-49763658 GGGACCTGGCAGATGGAGGCTGG - Intronic
1148828904 17:50416360-50416382 TAGTGTTGGGAGATGGAGGCTGG + Intergenic
1149089894 17:52764938-52764960 GCTACTTGGGAGGTGGAGGCAGG + Intergenic
1149146435 17:53498914-53498936 GCTACTTAGGAGACCGAGGCAGG + Intergenic
1149546680 17:57509047-57509069 CAGACTGGGAAGATGGAGGCAGG - Intronic
1149678340 17:58487017-58487039 GCTACTTAGGAGACTGAGGCAGG - Intronic
1149735052 17:58986308-58986330 GCTACTTGGGAGATTGAGGCAGG - Intronic
1149830035 17:59863993-59864015 GAAATTTAGGAGGTGGAGGAGGG + Intronic
1150096216 17:62378449-62378471 GAGCCTTGGGAGGCGGAGGCAGG + Intronic
1150122331 17:62614545-62614567 GATACTGAGGAGACTGAGGCAGG - Intronic
1150138511 17:62709361-62709383 GCTACTCAGGAGGTGGAGGCAGG + Intronic
1150176355 17:63060959-63060981 GCTACTTGGGAGGTGGAGGCAGG + Intronic
1150186894 17:63191572-63191594 GCTACTTAGGAGACTGAGGCAGG - Intronic
1150245059 17:63668529-63668551 GAGATTGAGGGGATGGAGGTGGG + Intronic
1150290931 17:63981572-63981594 GATACTTAGGAGGCTGAGGCAGG - Intergenic
1150561154 17:66296066-66296088 GATACTTGGGAGGTTGAGGCAGG - Intergenic
1150669621 17:67180939-67180961 GCTACTTAGGAGACTGAGGCAGG + Intronic
1150698376 17:67425631-67425653 GCTACTTGGGAGGTGGAGGCAGG - Intronic
1150728123 17:67667866-67667888 GCTACTTAGGAGGTTGAGGCAGG + Intronic
1151024708 17:70664116-70664138 GCTACTTGGGAGATTGAGGCAGG + Intergenic
1151095773 17:71496175-71496197 GATACTTAGGAGACTGAGGCAGG + Intergenic
1151247463 17:72805858-72805880 GATACTTAGGAGACTGAGGCAGG - Intronic
1151305099 17:73258119-73258141 GCTACTCAGGAAATGGAGGCAGG - Intronic
1151465687 17:74283494-74283516 GTTACTTGGGAGGTGGAGGCGGG + Intronic
1151611732 17:75180604-75180626 GATACTCAGGAGACTGAGGCAGG + Intergenic
1151633862 17:75330268-75330290 GCTACTCAGGAGGTGGAGGCAGG + Intronic
1151750767 17:76036278-76036300 GCTACTTGGGAGATTGAGGCAGG + Intergenic
1151865710 17:76800963-76800985 GCTACTTGGGAGGTGGAGGCAGG + Intergenic
1152980346 18:270509-270531 GCTACTTGGGAAATGGAGGCAGG - Intergenic
1153187106 18:2498265-2498287 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
1153216155 18:2822629-2822651 GGTACTCAGGAGACGGAGGCAGG + Intergenic
1153216705 18:2827519-2827541 GATACTCAGGAGACTGAGGCAGG + Intergenic
1153422825 18:4927583-4927605 GCTACTTAGGAGATTGAGGCAGG + Intergenic
1153500676 18:5746384-5746406 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
1153581678 18:6580372-6580394 AAGCCTTAGGAAATGGAGGAAGG - Intronic
1153652476 18:7253255-7253277 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
1153661249 18:7328254-7328276 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1153731554 18:8018163-8018185 GAGACTCAGGAGGCTGAGGCGGG + Intronic
1153780456 18:8490886-8490908 GATACTTGGGAGGTTGAGGCAGG - Intergenic
1154225607 18:12500958-12500980 GCTACTTGGGAGGTGGAGGCAGG + Intronic
1154267276 18:12890195-12890217 GTGACTCAGGAGACTGAGGCAGG + Intronic
1154969222 18:21390646-21390668 GCTACTCAGGAGGTGGAGGCAGG - Intronic
1154983024 18:21520046-21520068 GCTACTCAGGAGACGGAGGCAGG - Intronic
1154989237 18:21584738-21584760 GAGCCCAAGGAGATAGAGGCTGG + Intronic
1155008698 18:21753786-21753808 GCTACTTGGGAGATCGAGGCAGG - Intronic
1155011001 18:21777664-21777686 GATGCTCAGGAGGTGGAGGCAGG - Intronic
1155014778 18:21822851-21822873 GCGACTTAGGAGGCTGAGGCAGG + Intronic
1155288193 18:24313327-24313349 GCTACTCAGGAGGTGGAGGCAGG + Intronic
1156185918 18:34663263-34663285 GAAACTTAGGAGACTGAGGTAGG - Intronic
1156193074 18:34742437-34742459 GAGGATTCGAAGATGGAGGCAGG - Intronic
1156436012 18:37130504-37130526 GCTACTCAGGAGACGGAGGCAGG + Intronic
1156908726 18:42385316-42385338 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
1157818489 18:50748504-50748526 GAGCCCCAGGAGAGGGAGGCAGG - Intergenic
1157875100 18:51265501-51265523 GCTACTTAGGAGGTTGAGGCAGG + Intergenic
1158032962 18:52989409-52989431 GCTACTCAGGAGATGGAGGCAGG + Intronic
1158235555 18:55309221-55309243 GCTACTTAGGAGATTGAGGCAGG - Intronic
1158328505 18:56336275-56336297 GAGACTCAGGAGGATGAGGCAGG - Intergenic
1158414613 18:57238708-57238730 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
1158480012 18:57813948-57813970 GATACTTGGGAGACTGAGGCAGG - Intergenic
1158516293 18:58132951-58132973 CATACTTAGGAGATGAATGCTGG + Intronic
1158551760 18:58442001-58442023 GATACTCAGGAGGTTGAGGCAGG + Intergenic
1158582020 18:58691930-58691952 GCTACTCAGGAGATGGAGGCAGG + Intronic
1158966658 18:62628129-62628151 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
1159109375 18:64039207-64039229 GTTACTTGGGAGATTGAGGCAGG - Intergenic
1159456616 18:68667604-68667626 GCGACTTGGGAGACTGAGGCAGG + Intergenic
1159914226 18:74174211-74174233 GCTACTGAGGAGATTGAGGCAGG - Intergenic
1159915965 18:74188086-74188108 GCTACTTGGGAGATGGAGACAGG - Intergenic
1160421330 18:78748451-78748473 GCAACTTGGGAGACGGAGGCAGG - Intergenic
1160714924 19:572183-572205 GAGCCTTGGGAGGTCGAGGCGGG - Intronic
1160735356 19:659873-659895 GTGACTTAGGAGGCTGAGGCGGG - Intronic
1160760883 19:783650-783672 GCTACTTAGGAGATTGAGGCAGG - Intergenic
1160884255 19:1337933-1337955 GCTACTCAGGAGACGGAGGCCGG - Intergenic
1160962274 19:1728045-1728067 GCTACTTAGGAGGTTGAGGCAGG - Intergenic
1160997692 19:1891398-1891420 GAGACTTGGGAGGCTGAGGCAGG - Intergenic
1161018627 19:1997066-1997088 GCTACTTAGGAGGTTGAGGCAGG + Intronic
1161190558 19:2952640-2952662 GCTACTTAGGAGTTTGAGGCAGG - Intergenic
1161252994 19:3291152-3291174 GCTACTTGGGAGATGGAGGTGGG + Intronic
1161485923 19:4535670-4535692 GCTACTTAGGAGACTGAGGCGGG - Intronic
1161525964 19:4755441-4755463 GATACTTGGGAGACTGAGGCAGG + Intergenic
1161549963 19:4907219-4907241 GCTACTCAGGAGATTGAGGCAGG - Intronic
1161641783 19:5428345-5428367 GTTACTTAGGAGGTGGAGACTGG + Intergenic
1161860990 19:6798163-6798185 GCTACTCAGGAGGTGGAGGCAGG + Intronic
1162098008 19:8322194-8322216 GAGACTGACAAGAGGGAGGCGGG + Intronic
1162112797 19:8409636-8409658 GCTACTTAGGAGGCGGAGGCAGG + Intronic
1162184053 19:8890950-8890972 GCTACTCAGGAGGTGGAGGCAGG + Intronic
1162234750 19:9299547-9299569 GTTACTTGGGAGGTGGAGGCTGG - Intronic
1162255579 19:9486626-9486648 GACACTTGGGAGACTGAGGCAGG + Intronic
1162701352 19:12517501-12517523 GAGACTTGGGAGGCTGAGGCAGG - Intronic
1162716740 19:12639128-12639150 GCTACTTAGGAGGTTGAGGCAGG - Intronic
1162771315 19:12950950-12950972 GCTACTCAGGAGGTGGAGGCAGG + Intronic
1162920749 19:13901082-13901104 GCTACTTGGGAGATTGAGGCAGG - Intronic
1162940119 19:14004394-14004416 GCGACTCAGGAGACTGAGGCAGG + Intronic
1162961897 19:14133006-14133028 GCTACTTGGGAGATTGAGGCAGG + Intronic
1163058466 19:14740507-14740529 GCTACTTGGGAGGTGGAGGCAGG + Intronic
1163073517 19:14866557-14866579 GCTACTTGGGAGGTGGAGGCAGG + Intergenic
1163091233 19:15021728-15021750 GAGCCTTCGGGGGTGGAGGCAGG + Intronic
1163140967 19:15348307-15348329 GCTACTCAGGAGACGGAGGCAGG + Intergenic
1163353642 19:16795526-16795548 GATACTTGGGAGACTGAGGCAGG - Intronic
1163354675 19:16802346-16802368 GCTACTTGAGAGATGGAGGCAGG + Intronic
1163370857 19:16900484-16900506 GCTACTTAGGAGACTGAGGCAGG + Intronic
1163616555 19:18332483-18332505 CATACTTGGGAGGTGGAGGCAGG - Intergenic
1163671622 19:18632601-18632623 GAGACTTGGGAGGGTGAGGCAGG + Intergenic
1163760615 19:19134488-19134510 GCTACTCAGGAGATTGAGGCAGG + Intronic
1163802909 19:19378259-19378281 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1163867028 19:19782137-19782159 TAGTGTTGGGAGATGGAGGCTGG + Intergenic
1164001765 19:21106936-21106958 GCCACTTAGGAGCTGGAGGCAGG - Intronic
1164021774 19:21313644-21313666 GATACTCAGGAGGTTGAGGCAGG + Intronic
1164138138 19:22432945-22432967 GGCACTCAGGAGACGGAGGCGGG - Intronic
1164156525 19:22600810-22600832 GACACTTAGCAGATGATGGCTGG + Intergenic
1164241137 19:23390202-23390224 GCTACTTGGGAGGTGGAGGCAGG + Intronic
1164243904 19:23414331-23414353 CAGACTTCGGAGGTTGAGGCGGG + Intergenic
1164262624 19:23581391-23581413 GCTACTTAGGAGGTTGAGGCAGG - Intronic
1164269462 19:23658247-23658269 GATACTCAGGAGGTGGAGACAGG + Intronic
1164402320 19:27910747-27910769 GTGACTTTGGAGTTGGAGGCTGG + Intergenic
1164648488 19:29875553-29875575 GATACTCAGGAGACTGAGGCAGG + Intergenic
1164679676 19:30125501-30125523 GCTACTTAGGAGGTTGAGGCAGG + Intergenic
1165048951 19:33129133-33129155 GCTACTCAGGAGGTGGAGGCAGG + Intronic
1165164310 19:33840669-33840691 GAGGCTTAGGGGATGGGGACTGG - Intergenic
1165401568 19:35604176-35604198 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
1165678499 19:37750192-37750214 GCTACTCAGGAGATTGAGGCAGG - Intronic
1166022686 19:40046990-40047012 GCTACTTAGGAGGTTGAGGCAGG + Intronic
1166067544 19:40368811-40368833 GATACTCAGGAGATGGAAGGAGG + Intronic
1166144411 19:40824247-40824269 AAGACTAAGCAGGTGGAGGCGGG + Intronic
1166194138 19:41195002-41195024 GATACTTGGGAGGTTGAGGCAGG + Intronic
1166223689 19:41381975-41381997 GCTACTTAGGAGGTTGAGGCAGG - Intronic
1166226673 19:41400176-41400198 GCTACTTAGGAGGTGGAGGTGGG - Intronic
1166668362 19:44695224-44695246 GACACTTAGGAGGCTGAGGCAGG - Intergenic
1166672575 19:44719811-44719833 GCTACTTAGGAGAGTGAGGCAGG - Intergenic
1166776209 19:45314523-45314545 GCGACTTGGGAGACTGAGGCAGG - Intronic
1166776664 19:45317217-45317239 GCTACTCAGGAGGTGGAGGCAGG - Intronic
1166842418 19:45706213-45706235 GCTACTTGGGAGATTGAGGCAGG - Intergenic
1166877688 19:45907535-45907557 GCTACTTGGGAGGTGGAGGCAGG + Intergenic
1166924331 19:46256112-46256134 GCTACTCAGGAGATGAAGGCAGG + Intergenic
1166937564 19:46343678-46343700 GCTACTTGGGAGACGGAGGCAGG - Intergenic
1167075491 19:47246158-47246180 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1167141653 19:47655411-47655433 GATACTTGGGAGGTGGAGGCAGG + Intronic
1167262331 19:48466189-48466211 GCGACTCAGGAGACTGAGGCAGG - Intronic
1167431556 19:49458105-49458127 GCTACTCAGGAGATTGAGGCGGG + Intronic
1167595885 19:50427931-50427953 CAGATCCAGGAGATGGAGGCCGG + Intronic
1167734559 19:51284623-51284645 GCTACTTGGGAGATTGAGGCAGG + Intergenic
1167886292 19:52502623-52502645 GCTACTTAGGAGACGGAGGCAGG + Intronic
1167907280 19:52672120-52672142 GCTACTCAGGAGATTGAGGCAGG + Intronic
1167947349 19:52999258-52999280 GATACTTAGGAGGCTGAGGCAGG - Intergenic
1167947503 19:53000681-53000703 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
1167959853 19:53096972-53096994 GAGACGCAGGAACTGGAGGCAGG - Intronic
1167963652 19:53126813-53126835 GAGACGCAGGAACTGGAGGCAGG - Intronic
1167988620 19:53339217-53339239 AAGACTTAGGAACTGGAGGAAGG + Intronic
1168019816 19:53601126-53601148 GCTACTCAGGAGATGAAGGCAGG - Intronic
1168043535 19:53777826-53777848 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1168165933 19:54547863-54547885 TAGACTCAGGAGACTGAGGCAGG - Intergenic
1168320723 19:55508006-55508028 GACAGTGAGGAGAGGGAGGCAGG + Intronic
1168384757 19:55953911-55953933 GCTACTCAGGAGGTGGAGGCAGG - Intronic
1168391190 19:56009226-56009248 GCTACTTGGGAGGTGGAGGCAGG + Intronic
1168526703 19:57094300-57094322 GCTACTTGGGAGATTGAGGCAGG + Intergenic
1168545535 19:57246662-57246684 GCTACTCAGGAGGTGGAGGCAGG + Intronic
1168666443 19:58208521-58208543 GGCCCTTAGGAGAGGGAGGCTGG + Intronic
1168677540 19:58289907-58289929 GCTACTTGGGAGGTGGAGGCAGG - Intronic
925015321 2:519939-519961 TAGACTGTGAAGATGGAGGCAGG + Intergenic
925702357 2:6651367-6651389 GATACTCAGGAGACTGAGGCAGG + Intergenic
925881710 2:8358123-8358145 GAGAGACAGGAGATGGAGGGTGG + Intergenic
926133046 2:10317527-10317549 GATACTCAGGAGGTTGAGGCAGG - Intronic
926439755 2:12875459-12875481 GAGAATGAGGAGGTGGAGGCTGG + Intergenic
926564314 2:14453105-14453127 GCTACTTAGGAGACTGAGGCAGG - Intergenic
927211855 2:20643819-20643841 GATACTTAGGAGGCTGAGGCAGG + Intronic
927742523 2:25584666-25584688 GATACTTAGGAGGCTGAGGCAGG - Intronic
927900679 2:26816190-26816212 GATACTTGGGAGGCGGAGGCAGG - Intergenic
927998871 2:27506167-27506189 GAGACCCTGGAGAGGGAGGCAGG - Intronic
928080837 2:28310770-28310792 GCTACTTAGGAGACTGAGGCAGG + Intronic
928110484 2:28504628-28504650 GATACTCAGGAGGTTGAGGCAGG + Intronic
928333400 2:30375085-30375107 GCTACTTGGGAGATTGAGGCAGG - Intergenic
928607999 2:32961832-32961854 GATACTTGGGAGGTTGAGGCAGG + Intronic
928735350 2:34282453-34282475 GAGACTTCGGAGAAGAAGGAAGG - Intergenic
929234830 2:39594610-39594632 GATACTCAGGAGAATGAGGCAGG - Intergenic
929295396 2:40240764-40240786 GCTACTTAGGAGACTGAGGCAGG + Intronic
929571502 2:43025892-43025914 CTGACTTTGAAGATGGAGGCAGG - Intergenic
929862298 2:45689782-45689804 GCTACTTGGGAGGTGGAGGCAGG + Intronic
929989343 2:46772188-46772210 GCTACTTAGGAGGTTGAGGCAGG + Intergenic
930113091 2:47695716-47695738 GCTACTTGGGAGATTGAGGCAGG - Intronic
930141941 2:47960441-47960463 GCTACTTAGGAGGTTGAGGCAGG + Intergenic
930330656 2:49979000-49979022 AAGACTTAGGGGAAGGAGGTCGG + Intronic
930940270 2:57004139-57004161 GATACTTAGGAGGCTGAGGCAGG - Intergenic
931339616 2:61386676-61386698 GCTACTTAGGAGACTGAGGCAGG + Intronic
931383412 2:61774818-61774840 GCTACTTAGGAGACTGAGGCAGG - Intergenic
931402988 2:61949019-61949041 GTTACTCAGGAGGTGGAGGCAGG + Intronic
931516986 2:63055786-63055808 GAGCCTGGCGAGATGGAGGCCGG - Exonic
931555714 2:63501726-63501748 GATACTTGGGAGACTGAGGCAGG - Intronic
931611647 2:64107787-64107809 GTTACTTGGGAGATTGAGGCAGG - Intronic
932243536 2:70177158-70177180 GCTACTTAGGAGACCGAGGCAGG + Intronic
932254440 2:70272236-70272258 GCTACTTGGGAGGTGGAGGCAGG - Intronic
932351043 2:71032193-71032215 GCTGCTCAGGAGATGGAGGCAGG - Intergenic
932484637 2:72076610-72076632 GATACTCAGGAGGTTGAGGCAGG - Intergenic
932613309 2:73215529-73215551 GAGACTATGGAGATGGAGATAGG - Intronic
932623618 2:73282104-73282126 GCTACTTAGGAGACTGAGGCAGG - Intronic
932684680 2:73858092-73858114 GCTACTTAGGAGGTTGAGGCAGG - Intronic
932884236 2:75533688-75533710 GCGATTTGGGAGGTGGAGGCAGG + Intronic
932907488 2:75769310-75769332 GAGAATTAGGGGTTTGAGGCAGG + Intergenic
933063350 2:77766899-77766921 GCTACTCAGGAGATTGAGGCAGG + Intergenic
933641904 2:84771174-84771196 GATACTCAGGAGACTGAGGCAGG + Intronic
934528939 2:95073183-95073205 GATACTTAGGAGGCTGAGGCAGG - Intergenic
934973310 2:98781045-98781067 GAGACTTGGGAGGCTGAGGCAGG - Intergenic
935299387 2:101680563-101680585 GCTACTTAGGAGACTGAGGCAGG + Intergenic
935386044 2:102501231-102501253 GCTACTTAGGAGACTGAGGCAGG - Intronic
935468261 2:103425665-103425687 GAAACATAGGAGATGGGGGTTGG - Intergenic
935580494 2:104752077-104752099 GCTACTCAGGAGACGGAGGCAGG + Intergenic
935645694 2:105332219-105332241 GATACTTAGGAGGCTGAGGCAGG - Intergenic
935659046 2:105449704-105449726 GAGAGGTTGGAGGTGGAGGCAGG - Intergenic
935694814 2:105761766-105761788 GCTACTTAGGAGACTGAGGCAGG + Intronic
935787799 2:106565007-106565029 GATACTTGGGAGGTTGAGGCAGG - Intergenic
935967975 2:108500399-108500421 GCTACTCAGGAGATTGAGGCAGG + Intronic
935970641 2:108527803-108527825 TAGTGTTGGGAGATGGAGGCTGG - Intergenic
936175886 2:110219385-110219407 GAGACTTAGAGGAAGTAGGCAGG + Intergenic
936398981 2:112151509-112151531 GAGACTTGTGGGATGTAGGCAGG - Intronic
937417313 2:121726222-121726244 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
937593676 2:123646641-123646663 GCGACTCAGGAGACTGAGGCAGG + Intergenic
937720384 2:125088533-125088555 GCTACTTAGGAGGTTGAGGCAGG - Intergenic
937898943 2:127001444-127001466 GCTACTTAGGAGACTGAGGCAGG + Intergenic
937927613 2:127179228-127179250 CAGACTCTGGAGATGGAGGAAGG - Intergenic
937930614 2:127202234-127202256 GAGACTTGGGAGGCTGAGGCAGG - Intronic
938270465 2:129965782-129965804 GCTACTTAGGAGACTGAGGCAGG - Intergenic
938343705 2:130551497-130551519 GCTACTTAGGAGACTGAGGCAGG + Intergenic
938346128 2:130569225-130569247 GCTACTTAGGAGACTGAGGCAGG - Intergenic
938383571 2:130849677-130849699 GCTACTCAGGAGATTGAGGCAGG - Intronic
938904884 2:135828134-135828156 GCTACTTGGGAGGTGGAGGCAGG - Intronic
938923303 2:136015101-136015123 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
939171225 2:138698740-138698762 GCTACTTGGGAGATGGAGGCAGG + Intronic
939524413 2:143275038-143275060 GATACTTAGGAAGTTGAGGCAGG + Intronic
939589957 2:144052761-144052783 GCTACTTAGGAGATTGAGACAGG - Intronic
939742650 2:145928860-145928882 GATACTTAGGAGACTGAGGTGGG + Intergenic
940078007 2:149765273-149765295 GAAACTTAGGAGATGGGGAAGGG - Intergenic
940161826 2:150721641-150721663 GCGACTCAGGAGGCGGAGGCAGG + Intergenic
940276284 2:151944138-151944160 GCTACTTAGGAGACTGAGGCAGG - Intronic
940747758 2:157588592-157588614 GAGACTCAGGAGGTGGGGGAGGG - Intronic
940878946 2:158926682-158926704 GACACTTAGGAGGCTGAGGCAGG - Intergenic
940909530 2:159198063-159198085 GGCACTTTGGAGATGGAGGAAGG - Intronic
941029573 2:160494672-160494694 GACAATTAGGAGATGGAGAGAGG - Intergenic
941186540 2:162326626-162326648 GCTACTTGGGAGGTGGAGGCAGG - Intronic
941447077 2:165615429-165615451 GATACTCAGGAGGTTGAGGCAGG + Intronic
941473782 2:165923074-165923096 GAGACTTAGAAGAGGGAGGATGG + Intronic
941500672 2:166271744-166271766 GCAACTCAGGAGGTGGAGGCAGG + Intronic
941835836 2:170019571-170019593 GCTACTCAGGAGATGGAGGTGGG + Intronic
942616280 2:177794895-177794917 GCTACTTGGGAGATTGAGGCAGG - Intronic
942820898 2:180113522-180113544 GAGACTTCCGAGATAGAGGGAGG + Intergenic
942940612 2:181611109-181611131 GCTACTCAGGAGGTGGAGGCAGG + Intronic
943199649 2:184803972-184803994 GAGACTCAGGAGGCTGAGGCAGG - Intronic
943342803 2:186701026-186701048 GCTACTTAGGAGATTAAGGCAGG - Intronic
943745460 2:191457192-191457214 GCTACTCAGGAGATTGAGGCAGG - Intergenic
943909016 2:193539684-193539706 GATACTTAGGAGGCTGAGGCAGG - Intergenic
944125081 2:196283485-196283507 GCTACTTGGGAGGTGGAGGCAGG - Intronic
944127053 2:196306033-196306055 TAGTATTAGGAGATGGGGGCAGG + Intronic
944963951 2:204907811-204907833 GCTACTCAGGAGTTGGAGGCAGG - Intronic
945084184 2:206114521-206114543 GCTACTTAGGAGACTGAGGCAGG - Intergenic
945127878 2:206533311-206533333 GCGACTTGGGAGACTGAGGCAGG - Intronic
945302325 2:208225969-208225991 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
945323581 2:208456128-208456150 AATACTTGGGAGATTGAGGCAGG + Intronic
945334244 2:208572635-208572657 GCTACTTAGGAGGTGGAGGTGGG + Intronic
945434899 2:209808449-209808471 GCTACTCAGGAGATTGAGGCAGG + Intronic
945473031 2:210249355-210249377 GCTACTTGGGAGGTGGAGGCAGG - Intergenic
945939401 2:215933002-215933024 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
945954663 2:216075154-216075176 GATACTTGGGAGGTTGAGGCAGG + Intronic
946062730 2:216958392-216958414 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
946287802 2:218718488-218718510 GCTACTTGGGAGGTGGAGGCAGG - Intronic
946323095 2:218965055-218965077 GGGACTCAGGAGGTTGAGGCAGG + Intergenic
946332474 2:219018185-219018207 CAGACTTAGGAGAGGGATCCAGG - Intronic
946976915 2:225163533-225163555 GAGATTTGGGAGAAGGAAGCGGG - Intergenic
947071177 2:226289517-226289539 GCTACTCAGGAGATTGAGGCAGG + Intergenic
947626070 2:231619688-231619710 GAGACTTAGGAGGTTGAAGCAGG - Intergenic
947661411 2:231871872-231871894 GCTACTCAGGAGATTGAGGCAGG - Intergenic
948079460 2:235193679-235193701 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
948090392 2:235288734-235288756 CAGAATTAGGAGATTGGGGCCGG - Intergenic
948111220 2:235457465-235457487 GCTACTTGGGAGGTGGAGGCAGG - Intergenic
948582890 2:238999912-238999934 GCTACTTAGGAGACTGAGGCAGG - Intergenic
948990732 2:241552596-241552618 GAGACACAGGAGACGGGGGCGGG - Intergenic
1168770935 20:416265-416287 GCTACTCAGGAGATTGAGGCAGG - Intronic
1168815872 20:736614-736636 GATACTTGGGAGGTTGAGGCAGG + Intergenic
1169234038 20:3914425-3914447 GTGACTCAGGAGACTGAGGCAGG - Intronic
1169416577 20:5422348-5422370 GAGACTCAGAAGCTGGAGGGTGG + Intergenic
1169494332 20:6099747-6099769 GCGACTTGGGAGGTTGAGGCAGG + Intronic
1169610535 20:7375000-7375022 GCTACTTAGGAGACTGAGGCAGG + Intergenic
1169981746 20:11392603-11392625 GATACTCAGGAGACTGAGGCAGG - Intergenic
1170144446 20:13157323-13157345 GCTACTTGGGAGATTGAGGCAGG + Intronic
1170212513 20:13859809-13859831 GCTACTTGGGAGATTGAGGCAGG - Intronic
1170469770 20:16656872-16656894 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1170648217 20:18215402-18215424 GATACTCAGGAGACTGAGGCAGG - Intergenic
1170716171 20:18832935-18832957 GAGAGAAAGGAGAGGGAGGCTGG + Intergenic
1171014310 20:21525958-21525980 TAGACTTGGGAGATAGGGGCTGG + Intergenic
1171128314 20:22624126-22624148 GCAACTTTGGAGGTGGAGGCAGG + Intergenic
1171333711 20:24363631-24363653 GAACTTTGGGAGATGGAGGCGGG + Intergenic
1171339920 20:24419817-24419839 CAGACCTAGTAGAAGGAGGCAGG + Intergenic
1171388870 20:24788185-24788207 GAGACTCAGAAGGGGGAGGCTGG - Intergenic
1172232039 20:33343297-33343319 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
1172508332 20:35480702-35480724 GCTACTTAGGAGACTGAGGCAGG - Intronic
1172682666 20:36728835-36728857 GCTACTTGGGAGATGGAGGCAGG - Intronic
1172732083 20:37096451-37096473 TTGAGTTAGGAGATGGAGGCTGG + Intergenic
1172746102 20:37210640-37210662 GCTACTTGGGAGATTGAGGCAGG - Intronic
1172985855 20:38988516-38988538 GCTACTTAGGAGGTTGAGGCAGG + Intronic
1173221057 20:41133541-41133563 GAGACTCAGGAGGCTGAGGCAGG + Intergenic
1173830923 20:46087645-46087667 GCTACTTAGGAGACTGAGGCAGG + Intronic
1173837775 20:46136997-46137019 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1173997106 20:47346716-47346738 GCTACTTAGGAGGTTGAGGCAGG - Intronic
1174077527 20:47948452-47948474 GATACTTGGGAGTCGGAGGCAGG + Intergenic
1174239114 20:49118579-49118601 GTGCATTAGGAGAAGGAGGCAGG - Intronic
1174314763 20:49690113-49690135 GCTACTTGGGAGATTGAGGCAGG - Intronic
1174367917 20:50067596-50067618 GAGGCTTAGGAGATGGGGTGGGG - Intergenic
1174384658 20:50179986-50180008 GACATTCAGGAGATTGAGGCAGG - Intergenic
1174388176 20:50199235-50199257 GCTACTTAGGAGGTTGAGGCAGG - Intergenic
1174404084 20:50292590-50292612 AAGAGGCAGGAGATGGAGGCTGG - Intergenic
1174419786 20:50391906-50391928 GGGCCTTATGAGAGGGAGGCGGG + Intergenic
1174463142 20:50697390-50697412 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1174465806 20:50716308-50716330 GCTACTTAGGAGGTTGAGGCAGG + Intergenic
1174502441 20:50995573-50995595 GATACTCAGGAAATGGATGCTGG + Intergenic
1174612936 20:51814099-51814121 GCTACTTGGGAGGTGGAGGCGGG - Intergenic
1174626641 20:51920477-51920499 GCTACTTGGGAGATTGAGGCAGG - Intergenic
1174629642 20:51945084-51945106 GAGACTTGGGAGGCTGAGGCAGG + Intergenic
1174799920 20:53554839-53554861 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
1174818840 20:53710316-53710338 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1174922776 20:54722500-54722522 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
1175051177 20:56156902-56156924 GAGACTCAGGAGGCTGAGGCAGG + Intergenic
1175222228 20:57423906-57423928 GTTACTTAGGAGGTTGAGGCAGG - Intergenic
1175604889 20:60304543-60304565 GCTACTTAGGAGGTTGAGGCAGG + Intergenic
1176122291 20:63459398-63459420 GCGACTCGGGAGACGGAGGCTGG + Intronic
1176136805 20:63526575-63526597 GAGACTTGGGAGGCTGAGGCAGG + Intergenic
1176287965 21:5028780-5028802 GAGAGGCAGAAGATGGAGGCAGG + Intronic
1177087100 21:16719201-16719223 GAGAGCTAGGACATGGAGGCAGG + Intergenic
1177282642 21:19003688-19003710 GCTTCTTAGGAGATTGAGGCAGG - Intergenic
1177548922 21:22596079-22596101 GAGTTTTGGGAGATTGAGGCTGG + Intergenic
1177767700 21:25476759-25476781 GAACCTTGGGAGGTGGAGGCAGG + Intergenic
1177849295 21:26327547-26327569 GCGACTTGGGAGGTTGAGGCGGG + Intergenic
1178117503 21:29432434-29432456 GCTACTTGGGAGATTGAGGCAGG + Intronic
1178265916 21:31142517-31142539 GCTACTCAGGAGGTGGAGGCAGG + Intronic
1178443258 21:32615610-32615632 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
1178718630 21:34989118-34989140 GCTACTCAGGAGATTGAGGCAGG - Intronic
1178991820 21:37363177-37363199 GATACTCAGGAGGTTGAGGCAGG + Intergenic
1179007238 21:37526550-37526572 GCTACTTGGGAGATGGAGGTGGG + Intergenic
1179869216 21:44234695-44234717 GAGAGGCAGAAGATGGAGGCAGG - Intronic
1180127538 21:45802567-45802589 GAGACGTAAGAGATGGGGACAGG + Intronic
1180168382 21:46042270-46042292 GATACTTAGGAGACTGAGGCAGG + Intergenic
1180308185 22:11146987-11147009 GATACTTGGGAGACTGAGGCAGG - Intergenic
1180456899 22:15517456-15517478 GCTACTCAGGAGACGGAGGCAGG + Intergenic
1180499181 22:15917229-15917251 GCTACTTGGGAGGTGGAGGCAGG + Intergenic
1180512412 22:16105617-16105639 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1180546661 22:16508800-16508822 GATACTTGGGAGACTGAGGCAGG - Intergenic
1180562373 22:16629726-16629748 TGGGCTTTGGAGATGGAGGCAGG + Intergenic
1180571380 22:16724571-16724593 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
1180819020 22:18812553-18812575 GTGACTGAGGAGATGTGGGCAGG - Intergenic
1181137281 22:20777326-20777348 GATACTTAGGAGGCTGAGGCAGG - Intronic
1181205244 22:21247001-21247023 GTGACTGAGGAGATGTGGGCAGG - Intergenic
1181396586 22:22627337-22627359 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
1181412983 22:22737988-22738010 GAGAAGGAGGAGATGGAGGATGG + Intronic
1181451530 22:23025829-23025851 GATACTTGGGAGGTTGAGGCAGG - Intergenic
1181738700 22:24902572-24902594 CATACTTGGGAGGTGGAGGCAGG + Intronic
1181788643 22:25245942-25245964 GAGACTCAGGAGGTTGAGGCAGG - Intergenic
1181820333 22:25470642-25470664 GAGACTCAGGAGGCTGAGGCAGG - Intergenic
1182013063 22:27016608-27016630 AAGACTGATGAGTTGGAGGCTGG - Intergenic
1182075169 22:27490569-27490591 GAAACTTAGGAGGCTGAGGCAGG + Intergenic
1182218692 22:28741036-28741058 GATACTTAGGAGGCTGAGGCAGG + Intronic
1182224134 22:28782548-28782570 GCTACTCAGGAGATTGAGGCAGG - Intronic
1182288686 22:29263154-29263176 GCTACTTAGGAGACTGAGGCAGG - Intronic
1182375031 22:29840381-29840403 GCTACTTAGGAGGTCGAGGCAGG + Intergenic
1182437631 22:30340917-30340939 GAGGCTTAGCACATGGACGCTGG - Intronic
1182591859 22:31387240-31387262 GCTACTTGGGAGGTGGAGGCAGG - Intergenic
1182677311 22:32049773-32049795 AAGACTTAGATGAAGGAGGCAGG - Intronic
1182853833 22:33499883-33499905 GCTACTCAGGAGATTGAGGCAGG - Intronic
1183067678 22:35374477-35374499 GATACTCAGGAGATGGAGGCAGG + Intergenic
1183076924 22:35433181-35433203 AACACTTAGGAGGTGGAGGCAGG - Intergenic
1183173429 22:36204585-36204607 GAGAATAAGGAGATGGAGGGAGG + Intronic
1183239973 22:36650481-36650503 TATACTTAGGAGGTTGAGGCAGG - Intronic
1183410887 22:37654457-37654479 GATACTTAGGAGGCTGAGGCAGG + Intronic
1183446154 22:37856730-37856752 GCTACTTGGGAGGTGGAGGCAGG + Intronic
1183725409 22:39586378-39586400 GACACTTGGGAAGTGGAGGCAGG + Intronic
1183785230 22:40025305-40025327 GCTACTTGGGAGGTGGAGGCAGG + Intronic
1183791322 22:40072750-40072772 GATACTCAGGAGGCGGAGGCAGG + Intronic
1183890581 22:40924632-40924654 GATACTCAGGAGGTTGAGGCAGG - Intronic
1184174352 22:42778878-42778900 GATACTTGGGAGACTGAGGCAGG - Intergenic
1184495382 22:44838247-44838269 GCTACTTAGGAGGTTGAGGCAGG - Intronic
1184535789 22:45085975-45085997 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
1184536289 22:45089443-45089465 GAGCTTTAGGAGACAGAGGCAGG + Intergenic
1184577252 22:45380463-45380485 GAGACTTAGTAGATAGACTCAGG - Intronic
1184615809 22:45637612-45637634 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1184801017 22:46759487-46759509 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1185102458 22:48848847-48848869 GCTACTCAGGAGGTGGAGGCAGG + Intronic
1185328875 22:50242383-50242405 GATACTTAGGAGGCTGAGGCAGG + Intronic
1185350575 22:50334853-50334875 GCTACTTAGGAGACTGAGGCAGG + Intergenic
1203221681 22_KI270731v1_random:48414-48436 GTGACTGAGGAGATGTGGGCAGG + Intergenic
1203269145 22_KI270734v1_random:38406-38428 GTGACTGAGGAGATGTGGGCAGG - Intergenic
949270932 3:2215769-2215791 GTTACTTGGGAGATTGAGGCAGG + Intronic
949278557 3:2318749-2318771 GATACTTGGGAGGAGGAGGCAGG - Intronic
949789437 3:7777035-7777057 GCTACTTAGGAGGTTGAGGCGGG - Intergenic
949885641 3:8691422-8691444 GCTGCTTGGGAGATGGAGGCAGG - Intronic
949917529 3:8976286-8976308 GCTACTTAGGAGACTGAGGCAGG - Intergenic
950020128 3:9781197-9781219 GCGCTTTGGGAGATGGAGGCAGG + Intronic
950318184 3:12024266-12024288 GCTACTTAGGAGACTGAGGCAGG - Intronic
950586110 3:13893731-13893753 GAGACGTAAGAGAGGGAGGATGG - Intergenic
950793935 3:15495332-15495354 GAGACTGAGGAAATGAAGTCTGG + Intronic
950948644 3:16976722-16976744 GAGAGTGGGGAGATGGAGGGAGG + Intronic
950954900 3:17041830-17041852 GCTACCTGGGAGATGGAGGCTGG + Intronic
950994324 3:17479724-17479746 GCTACTCAGGAGACGGAGGCAGG + Intronic
951214710 3:20013188-20013210 GCTACTCAGGAGACGGAGGCAGG + Intergenic
951248490 3:20367627-20367649 TAGTGTTGGGAGATGGAGGCTGG + Intergenic
951394811 3:22152571-22152593 CGCACTTAGGAGATGGAGGAAGG - Intronic
951490000 3:23259482-23259504 GCTACTTAGGAGATTGAGGCAGG + Intronic
951534080 3:23725857-23725879 GATACTTGGGAGGTTGAGGCAGG + Intergenic
951554432 3:23906537-23906559 TAGACTGAGGAGAAGGAGGAGGG - Intronic
951554956 3:23911872-23911894 GCTACTTGGGAGATTGAGGCAGG - Intronic
951845000 3:27075953-27075975 GTGACTCAGGAGACTGAGGCAGG + Intergenic
952266209 3:31789088-31789110 GTGACTTAGGAGGTTGAGGCAGG - Intronic
952312873 3:32206219-32206241 GCTACTTGGGAGATTGAGGCAGG - Intergenic
952359706 3:32617633-32617655 GCTACTCGGGAGATGGAGGCAGG + Intergenic
952375712 3:32765540-32765562 GATACTTAGGAGACAGAGGTAGG + Intronic
952737597 3:36705879-36705901 GCTACTCAGGAGATTGAGGCAGG - Intergenic
952934368 3:38384176-38384198 GTTACTTAGGAGACTGAGGCAGG - Intronic
952944064 3:38464808-38464830 GCTACTTAGGAGACTGAGGCGGG + Intronic
952971329 3:38652073-38652095 GAGACTCAGGAGGCTGAGGCAGG - Intergenic
953159145 3:40402228-40402250 GCTACTTGGGAGGTGGAGGCAGG - Intronic
953239360 3:41134895-41134917 GAGGCTTTGGAGATGAAGACAGG + Intergenic
953362621 3:42311603-42311625 GCTACTTAGGAGATTGAGGTGGG - Intergenic
953429143 3:42822743-42822765 GCTACTTGGGAGGTGGAGGCAGG + Intronic
953472097 3:43176461-43176483 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
953506803 3:43493845-43493867 GCTACTCAGGAGATTGAGGCAGG - Intronic
953736635 3:45499508-45499530 GATACTTGGGAGGTTGAGGCTGG + Intronic
953948720 3:47171073-47171095 GCTACTTAGGAGGTTGAGGCAGG + Intergenic
954168297 3:48778935-48778957 GCTACTTAGGAGGTTGAGGCAGG - Intronic
954178028 3:48859705-48859727 GCAATTTAGGAGATTGAGGCAGG + Intronic
954271632 3:49514580-49514602 GCTACTCGGGAGATGGAGGCAGG - Intronic
954321743 3:49836712-49836734 GCCACTCAGGAGATTGAGGCAGG + Intronic
954568885 3:51623863-51623885 GCTACTTGGGAGGTGGAGGCAGG + Intronic
954905619 3:54060072-54060094 GATACTTGGGAGACTGAGGCAGG + Intergenic
954919126 3:54174634-54174656 GCTACTCAGGAGACGGAGGCAGG - Intronic
954964493 3:54598194-54598216 GCTACTTAGGAGACTGAGGCAGG + Intronic
955336679 3:58092532-58092554 GCTACTCAGGAGATTGAGGCAGG + Intronic
955511650 3:59686963-59686985 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
955708616 3:61755117-61755139 GACACTCAGGAGGTGCAGGCAGG - Intronic
955909168 3:63842688-63842710 GAGATTAAGAAGATGGAGGCTGG + Intronic
955925170 3:63997144-63997166 GCTACTCAGGAGGTGGAGGCAGG + Intronic
955934761 3:64091917-64091939 GAGACGGAGGCGATGGGGGCGGG + Intergenic
955994579 3:64666898-64666920 GAAATTTAGGAGGTGAAGGCAGG + Intronic
956065819 3:65396074-65396096 GAGGCTTAGGAGCAGGAGGATGG + Intronic
956334675 3:68149891-68149913 GAGGCATAGGAGATGGAGCTGGG + Intronic
956445063 3:69318081-69318103 GCTACTCAGGAGGTGGAGGCAGG - Intronic
956625091 3:71259031-71259053 GTGACTCAGGAGGCGGAGGCAGG + Intronic
957441374 3:80252172-80252194 GATACTCAGGAGGTTGAGGCGGG + Intergenic
957631968 3:82727543-82727565 GCTACTTAGGAGGTTGAGGCAGG + Intergenic
957780218 3:84809488-84809510 GCTACTTGGGAGGTGGAGGCAGG + Intergenic
958627453 3:96644320-96644342 GCTACTTGGGAGACGGAGGCAGG + Intergenic
958947301 3:100378129-100378151 GATACTTAGGAGGCTGAGGCAGG + Intronic
958980289 3:100711212-100711234 GATACTCAGGAGACTGAGGCAGG - Intronic
959060252 3:101610097-101610119 GATACTTAGGAGGCTGAGGCAGG - Intergenic
959176136 3:102913006-102913028 GATACTTGGGAGGCGGAGGCAGG + Intergenic
959219734 3:103501361-103501383 GCTACTTGGGAGGTGGAGGCAGG + Intergenic
959261229 3:104083402-104083424 GTTACTTGGGAGATTGAGGCAGG + Intergenic
959651975 3:108758864-108758886 GCTACTTAGGAGACTGAGGCAGG + Intergenic
959657368 3:108823981-108824003 GATACTCAGGAGGTTGAGGCAGG - Intronic
959981407 3:112521906-112521928 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
960080512 3:113535160-113535182 GCTACTTAGGAGGCGGAGGCAGG + Intronic
960228919 3:115201663-115201685 GATACTCAGGAGACTGAGGCAGG - Intergenic
960861343 3:122157027-122157049 GCTACTCAGGAGATTGAGGCAGG - Intergenic
960905936 3:122601421-122601443 GAGATTTTGGAGAAGGAGGGAGG - Intronic
961223616 3:125219534-125219556 GTGACTCGGGAGATGCAGGCCGG + Intergenic
961544560 3:127623357-127623379 GAGACTTGGGTGATGGAGATGGG + Intergenic
961768972 3:129234361-129234383 GCTACTTGGGAGATTGAGGCAGG - Intergenic
961896689 3:130173784-130173806 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
962216449 3:133526528-133526550 GCTACTTAGGAGGCGGAGGCAGG - Intergenic
962394299 3:135001393-135001415 CAGCCCTGGGAGATGGAGGCAGG - Intronic
962730567 3:138280013-138280035 GCTACTTGGGAGGTGGAGGCAGG - Intronic
963253228 3:143120577-143120599 GTTACTTAGGAGGAGGAGGCTGG + Intronic
963390712 3:144660260-144660282 GATACTGAGGAGATGGTAGCAGG - Intergenic
963404910 3:144851608-144851630 GCTACTTGGGAGATTGAGGCAGG + Intergenic
963748250 3:149147980-149148002 GCGACTTGGGAGGTTGAGGCAGG - Intronic
963751801 3:149187721-149187743 GAAACTTTGGAGATGGATCCCGG - Intronic
963767323 3:149351145-149351167 GATACTTAGGAGGCTGAGGCAGG - Intergenic
963950708 3:151197273-151197295 GCGACTTAGGAGGCTGAGGCAGG - Intronic
964045343 3:152317429-152317451 GATACTCAGGAGATTGAGGCGGG - Intronic
964356908 3:155859350-155859372 GATACTTAGGAGGCTGAGGCAGG + Intergenic
964459836 3:156912292-156912314 GAGACTCAGAAGGAGGAGGCTGG - Intronic
964793719 3:160475889-160475911 GATACTTAGGAGACTGAGACAGG + Intronic
964895292 3:161588605-161588627 GCTACTCAGGAGATGGAAGCAGG + Intergenic
965124760 3:164611820-164611842 GTTACTTGGGAGGTGGAGGCAGG + Intergenic
965168837 3:165234116-165234138 GATACTTAGGAGGTTGAGGCAGG - Intergenic
965219131 3:165903767-165903789 GAGACTTAGAAGAGAAAGGCTGG + Intergenic
965259120 3:166457410-166457432 CAGACTTGGGAGACTGAGGCAGG - Intergenic
965295723 3:166943157-166943179 GCTACTTGGGAGATTGAGGCAGG + Intergenic
965306557 3:167071007-167071029 GGTACTTAGGAGACTGAGGCAGG + Intergenic
965461954 3:168976825-168976847 GCTACTCAGGAGATGGAGGCAGG + Intergenic
965600619 3:170451071-170451093 GCTACTTATGAGGTGGAGGCAGG - Intronic
965650855 3:170931422-170931444 GCTACTCAGGAGGTGGAGGCTGG + Intergenic
965764058 3:172110985-172111007 GCTACTTAGGAGGTTGAGGCAGG + Intronic
965808461 3:172567237-172567259 GATACTTGGGAGACTGAGGCAGG - Intergenic
965981059 3:174691298-174691320 GATACTTGGGAGACTGAGGCAGG + Intronic
966166670 3:177027105-177027127 GCTACTTAGGAGGTGGAGGCGGG - Intronic
966175111 3:177130031-177130053 GCTACTCAGGAGATGGAGGCTGG + Intronic
966206312 3:177410060-177410082 GCTACTCAGGAGATTGAGGCAGG + Intergenic
966527353 3:180934000-180934022 GCTACTTAGGAGACTGAGGCAGG + Intronic
966710962 3:182972627-182972649 GCTACTTAGGAGACTGAGGCAGG + Intronic
966739803 3:183222109-183222131 GCTACTCAGGAGGTGGAGGCAGG - Intronic
966829160 3:183991183-183991205 GCTACTTGGGAGATGGAGGCAGG + Intronic
966909600 3:184551634-184551656 GAGACTGAGGAGATAAAGGGAGG + Intronic
967008755 3:185410821-185410843 GATACTTAGGAGGCTGAGGCAGG + Intronic
967073499 3:185982240-185982262 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
967101846 3:186222114-186222136 GAGTCTGAGGGGATGCAGGCTGG + Intronic
967137193 3:186522386-186522408 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
967205125 3:187112667-187112689 GCGACTTAGGAGGCGGAGGTGGG - Intergenic
967349206 3:188493538-188493560 GCTACTTAGGAGGTTGAGGCAGG - Intronic
967506625 3:190259942-190259964 GTGACTGAGGAGGTTGAGGCAGG - Intergenic
967668568 3:192204772-192204794 GCTACTTAGGAGGTTGAGGCAGG + Intronic
967683111 3:192388147-192388169 GATACTTGGGAGGTTGAGGCAGG + Intronic
967735093 3:192943361-192943383 GAGACTTAGAAAAAGGAGGCTGG + Intergenic
968090899 3:195897611-195897633 GCTACTCAGGAGATGGAGGCAGG - Intronic
968500637 4:948260-948282 GAGGCTTAGGAGGCAGAGGCGGG + Intronic
968572858 4:1351495-1351517 GCTACTTGGGAGATTGAGGCAGG - Intronic
968587252 4:1425852-1425874 GACACTTGGGAGGCGGAGGCAGG - Intergenic
968987783 4:3887031-3887053 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
969226446 4:5801566-5801588 GATACTTGGGAGACTGAGGCAGG + Intronic
969368188 4:6712652-6712674 GCTACTCAGGAGGTGGAGGCTGG - Intergenic
970127904 4:12834908-12834930 GAAAATTATGAGAAGGAGGCCGG - Intergenic
970645656 4:18117763-18117785 GAGCCTGAGGACATGGAGCCTGG + Intergenic
970881656 4:20939483-20939505 GATACTCAGGAGACTGAGGCAGG - Intronic
970898515 4:21131496-21131518 GCTACTCAGGAGATTGAGGCAGG + Intronic
971032700 4:22658330-22658352 GCTACTTAGGAGGTTGAGGCAGG - Intergenic
971305349 4:25475145-25475167 GCTACTTGGGAGGTGGAGGCAGG + Intergenic
971491281 4:27214730-27214752 GCTACTTAGGAGACTGAGGCAGG + Intergenic
971538591 4:27786405-27786427 GCTACTTGGGAGACGGAGGCAGG - Intergenic
971602008 4:28604794-28604816 GCTACTTGGGAGATTGAGGCAGG + Intergenic
971751092 4:30649095-30649117 GAGGATTAGGAAATGTAGGCAGG - Intergenic
971917932 4:32898224-32898246 GATACTAAGGAGACTGAGGCGGG - Intergenic
971942811 4:33237566-33237588 GCTACTTGGGAGATAGAGGCAGG + Intergenic
971955109 4:33407416-33407438 GATACTCAGGAGACTGAGGCAGG + Intergenic
972100859 4:35414351-35414373 GCTACTTAGGAGGTGGAGGTGGG - Intergenic
972257316 4:37371187-37371209 GGTACTTGGGAGGTGGAGGCAGG - Intronic
972299495 4:37771523-37771545 GCTACTTGGGAGGTGGAGGCAGG + Intergenic
972388837 4:38593521-38593543 GCTACTTAGGAGGTTGAGGCAGG - Intergenic
972449900 4:39186365-39186387 GCTACTTAGGAGACTGAGGCAGG + Intronic
972509926 4:39759386-39759408 GATACTTAGGAGGCCGAGGCAGG - Intronic
972621560 4:40751882-40751904 GATACTTGGGAGATTGAGGCGGG + Intronic
972756603 4:42054244-42054266 GCTACTCAGGAGATGGAGACAGG + Intronic
973307863 4:48673497-48673519 GCTACTTATGAGATTGAGGCTGG - Intronic
973536569 4:51888605-51888627 GCTACTTAGGAGGTTGAGGCAGG + Intronic
973970410 4:56207931-56207953 GTGACTTGGGAGACTGAGGCAGG - Intronic
974038306 4:56836432-56836454 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
974249413 4:59364481-59364503 GATACTTAGGAGGCTGAGGCAGG - Intergenic
974321271 4:60353407-60353429 GATACTGAGGAGACTGAGGCAGG + Intergenic
974348801 4:60717816-60717838 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
974394217 4:61314319-61314341 GATACTCAGGAGGTTGAGGCAGG - Intronic
974700124 4:65432677-65432699 GATACTTAGGAGACTGAGGCGGG - Intronic
974892753 4:67901572-67901594 GCTACTTGGGAGATTGAGGCAGG - Intergenic
975008449 4:69320200-69320222 GCTACTCAGGAGATTGAGGCAGG + Intronic
975133486 4:70851126-70851148 GATACTTAGGAGGCTGAGGCAGG + Intergenic
975135724 4:70872124-70872146 GCTACTTGGGAGGTGGAGGCAGG + Intergenic
975523227 4:75322348-75322370 GCTACTTGGGAGAAGGAGGCAGG + Intergenic
975582151 4:75916889-75916911 GCTACTTGGGAGGTGGAGGCAGG - Intronic
975584778 4:75939525-75939547 GCTACTTAGGAGGTTGAGGCAGG - Intronic
975586374 4:75954268-75954290 GCTACTTGGGAGGTGGAGGCAGG + Intronic
975634973 4:76439188-76439210 CAGACTTTGAAGATGGAGGAAGG - Intronic
975654831 4:76631317-76631339 GCTACTTAGGAGACTGAGGCAGG - Intronic
975866493 4:78728978-78729000 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
975940441 4:79637954-79637976 GCTACTTAGGAGGTTGAGGCAGG - Intergenic
975943750 4:79679766-79679788 GCTACTTAGGAGGTTGAGGCAGG + Intergenic
976304867 4:83549832-83549854 GATACTTAGGAGACTGAGGTGGG - Intronic
976402280 4:84620946-84620968 GCTACTTAGGAGGTTGAGGCGGG + Intronic
976413233 4:84741424-84741446 GCTACTTGGGAGGTGGAGGCAGG - Intronic
976554858 4:86438576-86438598 GCTACTCAGGAGGTGGAGGCAGG + Intronic
976864992 4:89714536-89714558 GCTACTCAGGAGATTGAGGCAGG - Intergenic
977067274 4:92333839-92333861 GATACTTAGGAGGCTGAGGCAGG - Intronic
977609849 4:99020482-99020504 GAGCCTGAGGAGGAGGAGGCGGG + Intronic
978061123 4:104340892-104340914 GCTACTTAGGAGGTTGAGGCTGG - Intergenic
978124088 4:105114987-105115009 GCTACTTGGGAGATGGAGGCAGG - Intergenic
978380860 4:108127086-108127108 GAGACATAGGAGCTGGAAGTAGG + Intronic
978454234 4:108870142-108870164 GCTACTTAGGAGACTGAGGCGGG + Intronic
978941468 4:114440829-114440851 GCTACTCAGGAGATTGAGGCAGG + Intergenic
979330198 4:119415120-119415142 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
980039445 4:127922511-127922533 GCTACTTAGGAGGTTGAGGCAGG + Intronic
980099324 4:128525318-128525340 GCTACTCAGGAGATTGAGGCAGG + Intergenic
980726456 4:136767820-136767842 CAGGCTTTGAAGATGGAGGCAGG - Intergenic
980803157 4:137779324-137779346 GAGACTCAGAAGAGGGAGGCAGG - Intergenic
980820610 4:138011174-138011196 GGTACTTCGGAGATTGAGGCAGG - Intergenic
980842594 4:138283168-138283190 GCTACTTAGGAGACTGAGGCAGG + Intergenic
980910542 4:138990074-138990096 GATACTTGGGAGGTTGAGGCAGG - Intergenic
981037047 4:140182558-140182580 GATACTTGGGAGACTGAGGCAGG + Intergenic
981602980 4:146512083-146512105 GCTACTTGGGAGGTGGAGGCAGG - Intronic
981878022 4:149572396-149572418 GCTACTTGGGAGATTGAGGCAGG - Intergenic
981947936 4:150371437-150371459 GACACTTTGGAGACCGAGGCAGG - Intronic
982178310 4:152727352-152727374 GCTACTTAGGAGACTGAGGCAGG - Intronic
982423444 4:155226016-155226038 GCTACTTAGGAGGTTGAGGCAGG + Intergenic
982425000 4:155247683-155247705 GATACTCAGGAGGTTGAGGCAGG + Intergenic
982491200 4:156031805-156031827 GCTACTTAGGAGACTGAGGCAGG - Intergenic
983400528 4:167259003-167259025 GAGACTTAGAAGGGGGAGGGTGG + Intergenic
983476647 4:168219922-168219944 GCTACTCAGGAGATTGAGGCAGG + Intronic
983578126 4:169280750-169280772 GCTACTTAGGAGGTTGAGGCAGG - Intergenic
983869422 4:172807932-172807954 GATACTTGGGAGACTGAGGCAGG - Intronic
984225079 4:177025354-177025376 GATACTCAGGAGATCAAGGCAGG - Intergenic
984364206 4:178777324-178777346 GAGATTTGAAAGATGGAGGCTGG + Intergenic
984440013 4:179756591-179756613 GTTACTTGGGAGATTGAGGCAGG - Intergenic
985163474 4:187068244-187068266 GCTACTTAGGAGACTGAGGCAGG - Intergenic
985338746 4:188924788-188924810 GCTACTTAGGAGGCGGAGGCAGG + Intergenic
985827640 5:2204877-2204899 GAACCATAGGAGAGGGAGGCTGG + Intergenic
985927998 5:3032919-3032941 CGGACATAGGAAATGGAGGCAGG + Intergenic
986238602 5:5936154-5936176 GCTACTTAGGAGGTTGAGGCAGG - Intergenic
986707796 5:10465909-10465931 GAGTCTTAGGAGGGGTAGGCAGG - Intronic
986806736 5:11314465-11314487 GCTACTTAGGAGACTGAGGCAGG - Intronic
986857590 5:11888861-11888883 GTTACTCAGGAGATTGAGGCAGG - Intronic
987052296 5:14157694-14157716 GCTACTTAGGAGACTGAGGCAGG - Intronic
987120120 5:14759643-14759665 GCTACTTGGGAGGTGGAGGCAGG + Intronic
987410299 5:17608393-17608415 GATACTCAGGAGACCGAGGCAGG - Intergenic
987420345 5:17712848-17712870 GAGACTTGGAAGATGGAAGTCGG - Intergenic
987875878 5:23680656-23680678 GTGTTTTAGGAGATGGAGGAGGG + Intergenic
988210232 5:28194461-28194483 GCTACTTGGGAGATGGAGGCGGG - Intergenic
988286716 5:29228221-29228243 GCTACTTAGGAAGTGGAGGCAGG - Intergenic
988342146 5:29986391-29986413 GATACTTGGGAGACTGAGGCAGG + Intergenic
988631816 5:32939745-32939767 GCTACTTGGGAGATGGAGGCAGG - Intergenic
988678919 5:33464667-33464689 GCTACTTAGGAGCTTGAGGCAGG + Intronic
988828132 5:34961073-34961095 GCTACTTGGGAGATTGAGGCAGG - Intergenic
989013507 5:36901619-36901641 GCTACTTGGGAGATTGAGGCAGG - Intronic
989201587 5:38769602-38769624 GCTACTTGGGAGATTGAGGCAGG + Intergenic
989282567 5:39662375-39662397 GCTACTTGGGAGATGGAGGTGGG - Intergenic
989365134 5:40647404-40647426 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
990271045 5:54139503-54139525 GAGACTTAGAAGTGGGAGCCTGG + Intronic
990335076 5:54764525-54764547 GGAACTTAGGAGAAGGAGACAGG - Intergenic
990372869 5:55138270-55138292 GCTACTTGGGAGATTGAGGCAGG - Intronic
990571793 5:57086264-57086286 GCTACTCAGGAGATTGAGGCAGG - Intergenic
991053414 5:62296556-62296578 GCTACTTAGGAGACGGAGGCAGG + Intergenic
991374038 5:65947339-65947361 GCTACTCAGGAGACGGAGGCAGG - Intronic
991430614 5:66541061-66541083 GAGATTTAGCAGAACGAGGCTGG - Intergenic
991647213 5:68812501-68812523 GCTACTCAGGAGATTGAGGCAGG + Intergenic
991734027 5:69615302-69615324 GAGGCTTAGGAGATAGAGCCAGG + Intergenic
991810461 5:70470443-70470465 GAGGCTTAGGAGATAGAGCCAGG + Intergenic
991860240 5:71006840-71006862 GAGGCTTAGGAGATAGAGCCAGG - Intronic
991909773 5:71550272-71550294 GCTACTCAGGAGACGGAGGCAGG + Intronic
991988284 5:72312018-72312040 GCTACTCAGGAGGTGGAGGCAGG + Intronic
991991312 5:72342568-72342590 GAAACATTGGAAATGGAGGCTGG - Intronic
992844415 5:80731012-80731034 GCTACTTGGGAGGTGGAGGCAGG - Intronic
993221971 5:85110717-85110739 GATACTTGGGAGACTGAGGCAGG + Intergenic
993334477 5:86640769-86640791 GAAACTGAGGAAATGGAAGCAGG - Intergenic
993554837 5:89323131-89323153 GATACTTGGGAGGTTGAGGCAGG + Intergenic
993635729 5:90341229-90341251 GAGACTTGGGAGGCTGAGGCAGG + Intergenic
993728686 5:91397272-91397294 GAGCCTTAGGACAAGGAGTCTGG - Intergenic
994109513 5:95985200-95985222 GCTATTTAGGAGACGGAGGCAGG + Intergenic
994611785 5:102050206-102050228 GATACTTAGGAGGCTGAGGCAGG + Intergenic
994721241 5:103382851-103382873 GCTACTTAGGAGACTGAGGCAGG - Intergenic
994904562 5:105821579-105821601 GGGACTTGGGAGAGGGAGGTTGG + Intergenic
995031869 5:107490340-107490362 GCTACTTGGGAGGTGGAGGCAGG - Intronic
995327610 5:110908886-110908908 GCTACTTGGGAGATTGAGGCAGG - Intergenic
995376363 5:111478987-111479009 GCTACTCAGGAGATGGAGGTGGG - Intronic
995512164 5:112921154-112921176 GTCACTTACGAGATGTAGGCTGG + Exonic
995521785 5:113014258-113014280 GAGACTAAAGGGTTGGAGGCAGG - Exonic
995532756 5:113107520-113107542 GGCCCTTTGGAGATGGAGGCAGG + Intronic
995550193 5:113273886-113273908 CAGACTTGGGAGATGAAGGAAGG - Intronic
995676131 5:114664208-114664230 GCCACTCAGGAGGTGGAGGCAGG + Intergenic
995915757 5:117242716-117242738 GAGACTTATGACATAGAGGCAGG + Intergenic
996062462 5:119047253-119047275 GCTACTTAGGAGACTGAGGCAGG + Intronic
996109480 5:119548584-119548606 GCTACTTAGGAGGTTGAGGCAGG + Intronic
996709531 5:126530646-126530668 GCTACTTGGGAGGTGGAGGCAGG - Intergenic
996715786 5:126586965-126586987 GCTACTCAGGAGATTGAGGCAGG + Intronic
996737431 5:126770836-126770858 GACACTTAGGAGGCTGAGGCAGG - Intergenic
996861817 5:128075732-128075754 GCTACTTGGGAGATTGAGGCAGG + Intergenic
996977572 5:129453502-129453524 GCTACTTGGGAGGTGGAGGCAGG - Intergenic
997486397 5:134234443-134234465 GCTACTTGGGAGGTGGAGGCAGG + Intergenic
997547502 5:134721449-134721471 GCTACTCAGGAGATTGAGGCAGG + Intronic
997739558 5:136241665-136241687 GATACTTGGAAGATTGAGGCAGG - Intronic
997832196 5:137159491-137159513 GAGACTCAGAAGTGGGAGGCTGG - Intronic
997945499 5:138196992-138197014 GTGACTTGGGAGGTTGAGGCAGG - Intronic
998016543 5:138736627-138736649 GTGCCTTGGGAGATGGAGGTGGG + Intronic
998057076 5:139087430-139087452 GCTACTTAGGAGGCGGAGGCGGG + Intronic
998087047 5:139334907-139334929 GCTACTTAGGAGACTGAGGCAGG + Intergenic
998268101 5:140681555-140681577 GCTACTTAGGAGACTGAGGCAGG + Intronic
998291658 5:140921090-140921112 GCTACTTAGGAGACTGAGGCAGG - Intronic
998625037 5:143836771-143836793 GTCACTTTGGAAATGGAGGCAGG - Intergenic
998732126 5:145090609-145090631 GATACTTAGGAGGTTAAGGCAGG - Intergenic
998753793 5:145353349-145353371 GATACTTAGGAGGCTGAGGCAGG + Intergenic
998811348 5:145969621-145969643 GCTACTTAGGAGACTGAGGCTGG + Intronic
999181454 5:149672547-149672569 GAACATTGGGAGATGGAGGCGGG + Intergenic
999263828 5:150253686-150253708 GAGACTCAGGAGCCTGAGGCGGG - Intronic
999292320 5:150434288-150434310 GCTACTTAGGAGGTTGAGGCAGG - Intergenic
999305258 5:150515482-150515504 GAGACTTAGGAGTGGGAGAGGGG + Intronic
999398308 5:151244974-151244996 GCGACTTAGGAGGCTGAGGCAGG + Intronic
999753189 5:154645534-154645556 GATACTCAGGAGGTTGAGGCAGG + Intergenic
999838626 5:155400890-155400912 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
999883728 5:155896317-155896339 AAAACGTAGGAGGTGGAGGCTGG + Intronic
1000078198 5:157815186-157815208 GCTACTTAGGAGGTTGAGGCAGG + Intronic
1000138131 5:158373747-158373769 AGGAGTTAGGAGCTGGAGGCTGG + Intergenic
1000340193 5:160271038-160271060 AAGATTTAGGAGGTGGAGGGAGG + Intronic
1000469145 5:161618098-161618120 GCTACTTAGGAGACTGAGGCAGG + Intronic
1000668785 5:164034063-164034085 GCTACTTGGGAGATTGAGGCAGG - Intergenic
1000713253 5:164606971-164606993 GCTACTTGGGAGGTGGAGGCAGG + Intergenic
1000864606 5:166497649-166497671 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1000929968 5:167239882-167239904 GCTACTTGGGAGATTGAGGCAGG - Intergenic
1000983402 5:167841166-167841188 GCTACTTGGGAGATTGAGGCAGG - Intronic
1001257451 5:170194905-170194927 GCTACTCAGGAGATGGAGGCAGG + Intergenic
1001498969 5:172213692-172213714 GCTACTCAGGAGGTGGAGGCAGG - Intronic
1001801344 5:174547035-174547057 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
1001802612 5:174557293-174557315 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1001828225 5:174763725-174763747 GATACTCAGGAGGTTGAGGCAGG + Intergenic
1001921992 5:175608006-175608028 GCCACTTAGGAGACTGAGGCAGG + Intergenic
1002155565 5:177276038-177276060 GCTACTTAGGAGACTGAGGCAGG - Intronic
1002326249 5:178408841-178408863 GATACTTGGGAGGTTGAGGCAGG + Intronic
1002483738 5:179520321-179520343 GCTACTTAGGAGACTGAGGCAGG + Intergenic
1002487054 5:179546108-179546130 GCTACTTAGGAGGTTGAGGCAGG + Intergenic
1002647349 5:180666354-180666376 GCGACTCAGGAGGTTGAGGCAGG + Intergenic
1002913374 6:1508434-1508456 GCCACTTGGGAGACGGAGGCGGG - Intergenic
1003214443 6:4096414-4096436 GAGACTTAGGAAATTCAGGACGG + Intronic
1003306920 6:4937382-4937404 GCTACTTAGGAGGCGGAGGCGGG + Intronic
1003594560 6:7462660-7462682 GCTACTTGGGAGACGGAGGCAGG + Intergenic
1003810752 6:9777233-9777255 GCAACTCAGGAGATTGAGGCAGG - Intronic
1003857835 6:10293925-10293947 GAATCTTTGTAGATGGAGGCCGG + Intergenic
1003919805 6:10822340-10822362 GCTACTTGGGAGACGGAGGCAGG + Intronic
1003974039 6:11326032-11326054 GATACTTGGGAGGTTGAGGCAGG + Intronic
1004002420 6:11607387-11607409 GGGACTCAGGAGCTGGAGCCAGG - Intergenic
1004216404 6:13708312-13708334 GCTACTTGGGAGATGGAGGCAGG + Intronic
1004239325 6:13904561-13904583 GAGCCTGAGGAGATTGAGACTGG - Intergenic
1004353010 6:14907360-14907382 GCTACTTAGGAGGTTGAGGCAGG + Intergenic
1004878793 6:19984495-19984517 GCGACTTAGGAGGCTGAGGCAGG + Intergenic
1005053448 6:21707423-21707445 GTTACTTGGGAGATTGAGGCAGG + Intergenic
1005059110 6:21759758-21759780 GCTACTCAGGAGACGGAGGCAGG - Intergenic
1005061880 6:21784195-21784217 GCTACTTGGGAGATTGAGGCAGG - Intergenic
1005102483 6:22187445-22187467 CAGACTTAGGAGATGGGTGAGGG - Intergenic
1005220277 6:23578798-23578820 GAGAGATAGGAGATGGGGTCAGG + Intergenic
1005230153 6:23690794-23690816 GAGTCATAGGAGATGGTGCCAGG - Intergenic
1005314587 6:24592510-24592532 GCTACTTGGGAGATGGAGGTAGG - Intronic
1005480419 6:26250057-26250079 GAGGGTTAGGGGATGGGGGCAGG - Intergenic
1005493870 6:26371788-26371810 GCTACTTGGGAGATTGAGGCAGG - Intronic
1005976714 6:30805735-30805757 GCTACTTGGGAGATTGAGGCAGG - Intergenic
1006021918 6:31122367-31122389 GAGACTCAGGAAAGGGAGCCTGG - Intronic
1006109849 6:31737902-31737924 GAAATTCAGGATATGGAGGCTGG - Intronic
1006490112 6:34379893-34379915 GCTACTTGGGAGGTGGAGGCAGG + Intronic
1006659452 6:35627871-35627893 GCTACTTGGGAGGTGGAGGCAGG - Intronic
1006702170 6:35984432-35984454 GCTACTCAGGAGGTGGAGGCAGG - Intronic
1006718452 6:36135097-36135119 GTGCTTTGGGAGATGGAGGCTGG - Intronic
1006982360 6:38156761-38156783 GCTACTCAGGAGGTGGAGGCGGG + Intergenic
1007056563 6:38891839-38891861 GACACTGAGGAAATGGAGCCAGG - Intronic
1007685827 6:43666857-43666879 GCTACTTGGGAGACGGAGGCAGG - Intronic
1007694662 6:43724683-43724705 GAGACTAAGGAGCAGGAGGCAGG - Intergenic
1007713785 6:43841597-43841619 GCTACTTGGGAGGTGGAGGCAGG + Intergenic
1007825414 6:44596195-44596217 GAGGCTAAGGATATGGAGGGAGG - Intergenic
1007896131 6:45361024-45361046 GCTACTCAGGAGATGGGGGCAGG + Intronic
1007966320 6:46006785-46006807 GCTACTTAGGAGACTGAGGCAGG - Intronic
1008485146 6:52027418-52027440 GCTACTTAGGAGACTGAGGCTGG + Intronic
1008674037 6:53800496-53800518 GAACTTTAGGAGACGGAGGCAGG - Intronic
1009338216 6:62520764-62520786 GCTACTCAGGAGATTGAGGCAGG + Intergenic
1009762991 6:68032065-68032087 GCTACTCGGGAGATGGAGGCAGG + Intergenic
1010023503 6:71188729-71188751 GCTACTTAGGAGATTGAGGCTGG + Intergenic
1010164533 6:72899955-72899977 GATACTCAGGAGACTGAGGCAGG - Intronic
1010218474 6:73426960-73426982 GCTACTTAGGAGGTTGAGGCAGG - Intronic
1010220159 6:73441982-73442004 GCGACTCAGGAGGTTGAGGCAGG - Intronic
1010255035 6:73747979-73748001 GCTACTCGGGAGATGGAGGCAGG - Intronic
1010363211 6:75018868-75018890 GGGAGTGAGGAGAGGGAGGCAGG - Intergenic
1010783435 6:79972122-79972144 GATACTTAGGAGGCTGAGGCAGG - Intergenic
1010866209 6:80979348-80979370 GGGACTGAGGAGATGATGGCGGG - Intergenic
1010905446 6:81481242-81481264 GAAAATTAGGAGTTGGAGGAAGG + Intergenic
1011070490 6:83376381-83376403 GCTACTTAGGAGACTGAGGCAGG + Intronic
1011202926 6:84857316-84857338 CAGACTTAGAAGATGGGGGAGGG - Intergenic
1011443135 6:87408381-87408403 GAGACTTAGTAATTGGAGGGTGG + Intronic
1011465750 6:87655295-87655317 GCTACTCAGGAGGTGGAGGCAGG - Intronic
1011662674 6:89607890-89607912 GATACTTAGGAGGCTGAGGCGGG - Intronic
1011967321 6:93175082-93175104 AAAACCTAGGAGATGGAGGTGGG - Intergenic
1012256986 6:97045226-97045248 AAGACTTAGGAAATTAAGGCAGG + Intronic
1012404021 6:98873695-98873717 GCGACACAGGAGGTGGAGGCAGG - Exonic
1012737020 6:102960960-102960982 GCTACTTGGGAGATTGAGGCAGG + Intergenic
1012748931 6:103132480-103132502 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
1012894193 6:104930225-104930247 GCTACTTGGGAGATGAAGGCAGG + Intergenic
1013275980 6:108585337-108585359 AAGATTTTGGAGATAGAGGCCGG - Intronic
1013349941 6:109296581-109296603 GAGACCTTGGAGCTGGTGGCAGG + Intergenic
1013401187 6:109797782-109797804 GATACTCAGGAGGTGGAGACAGG + Intronic
1013412131 6:109891854-109891876 GGGCCTAAGGAGATGGAGCCCGG + Intergenic
1013529735 6:111007833-111007855 GCTACTTAGGAGGTTGAGGCAGG + Intronic
1013547150 6:111169491-111169513 TAGGCATGGGAGATGGAGGCTGG - Intronic
1013814814 6:114084941-114084963 GCTACTTAGGAGGTTGAGGCAGG - Intronic
1014245283 6:119061465-119061487 GATACTTAGGAGGCTGAGGCAGG - Intronic
1014623869 6:123702130-123702152 GCTACTCAGGAGATTGAGGCAGG + Intergenic
1014993357 6:128110015-128110037 GACACTCAGGAGACTGAGGCAGG - Intronic
1015399890 6:132777107-132777129 GCTACTCAGGAGGTGGAGGCAGG + Intronic
1015537860 6:134284594-134284616 GCTACTTAGGAGGTTGAGGCAGG - Intronic
1015778100 6:136835049-136835071 GATACTTGGGAGAGTGAGGCAGG - Intronic
1016797080 6:148129607-148129629 GCTACTTGGGAGGTGGAGGCAGG + Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017135680 6:151145589-151145611 GCTACTTGGGAGACGGAGGCAGG - Intergenic
1017200825 6:151753427-151753449 GCTACTCAGGAGATTGAGGCAGG - Intronic
1017210758 6:151853058-151853080 GCTACTCAGGAGGTGGAGGCAGG + Intronic
1017212812 6:151875900-151875922 GAGCCTCAGGACATTGAGGCAGG + Intronic
1017213428 6:151881769-151881791 GCTACTTGGGAGGTGGAGGCAGG + Intronic
1017428744 6:154349301-154349323 GCTACTCAGGAGATGGAGGCAGG - Intronic
1017460664 6:154646577-154646599 GCTACTTGGGAGATTGAGGCAGG + Intergenic
1017467551 6:154708431-154708453 GCTACTTGGGAGATTGAGGCAGG + Intergenic
1017485472 6:154898256-154898278 GAGACTCAGGAGGCTGAGGCAGG - Intronic
1017858882 6:158376730-158376752 GAGACATAGGAGAAGTTGGCTGG + Intronic
1017926584 6:158915898-158915920 GAAAATGAAGAGATGGAGGCCGG + Intergenic
1018023149 6:159781658-159781680 GATACTCAGGAGACTGAGGCAGG + Intronic
1018215283 6:161520334-161520356 GCTACTTAGGAGACTGAGGCAGG - Intronic
1018337213 6:162806218-162806240 GATACTTGGGAGACTGAGGCAGG - Intronic
1018364670 6:163107477-163107499 GTGACTCAGGAGATTCAGGCAGG - Intronic
1018545544 6:164932843-164932865 GGCACTCAGGAGATGGAGGCGGG - Intergenic
1018923399 6:168190875-168190897 GAGACTGAGGGGTTGCAGGCAGG + Intergenic
1019095574 6:169576653-169576675 GCTACTTAGGAGGTTGAGGCAGG + Intronic
1019476975 7:1249000-1249022 GAGGCTTAGGGGAGGGAAGCAGG - Intergenic
1019550149 7:1598128-1598150 GTCATTAAGGAGATGGAGGCTGG + Intergenic
1020206788 7:6123985-6124007 GCTACTTAGGAGACCGAGGCAGG - Intronic
1020215906 7:6189922-6189944 GATACTCAGGAGACTGAGGCAGG + Intronic
1020264285 7:6550100-6550122 GATACTCAGGAGACTGAGGCAGG - Intronic
1020268755 7:6579310-6579332 GCGACTCAGGGGGTGGAGGCAGG - Intronic
1020445771 7:8265830-8265852 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1020502761 7:8943918-8943940 GAAACTTGGGAGGCGGAGGCAGG - Intergenic
1020954431 7:14722698-14722720 GATACTTGGGAGGTTGAGGCAGG + Intronic
1021070923 7:16239025-16239047 GTTACTCAGGAGGTGGAGGCAGG + Intronic
1021095914 7:16535982-16536004 GCTACTTAGGAGACTGAGGCAGG - Intronic
1022160318 7:27703838-27703860 GCTACTCAGGAGGTGGAGGCCGG + Intergenic
1022355862 7:29614046-29614068 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1022444809 7:30461287-30461309 GCTACTTAGGAGGCGGAGGCAGG - Intronic
1022706929 7:32810551-32810573 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
1022715892 7:32898053-32898075 GCTACTTGGGAGATTGAGGCAGG - Intergenic
1022817173 7:33924777-33924799 GCTACTCAGGAGATTGAGGCAGG - Intronic
1022872533 7:34494194-34494216 GATACTCAGGAGACTGAGGCAGG + Intergenic
1022997402 7:35770990-35771012 GCGACTTGGGAGGTGGAGGCAGG + Intergenic
1023309297 7:38867431-38867453 GCTACTTAGGAGGTTGAGGCAGG + Intronic
1023398375 7:39772825-39772847 GCTACTTAGGAGGTGGAGGCAGG + Intergenic
1023408317 7:39860481-39860503 GCTACTTAGGAGGTTGAGGCAGG - Intergenic
1023449311 7:40265837-40265859 GATACTTGGGAGAATGAGGCAGG + Intronic
1023727902 7:43163444-43163466 AAGACTGGGGAGATGGAGGCAGG + Intronic
1025120753 7:56299657-56299679 GATACTTGGGAGACTGAGGCAGG - Intergenic
1025137543 7:56432056-56432078 GCTACTTAGGAGGTTGAGGCAGG + Intergenic
1025151256 7:56552606-56552628 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
1025155471 7:56602288-56602310 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1025186496 7:56864112-56864134 GCTACTTAGGAGACTGAGGCAGG + Intergenic
1025230887 7:57202754-57202776 GCGACTTGGGAGACTGAGGCAGG - Intergenic
1025685426 7:63712784-63712806 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1025836065 7:65094699-65094721 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1025899965 7:65736184-65736206 GTTACTTGGGAGATTGAGGCAGG - Intergenic
1025991330 7:66499350-66499372 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
1026012812 7:66650024-66650046 GCTACTTAGGAGACTGAGGCAGG + Intronic
1026027951 7:66762292-66762314 TAGAAATAGGACATGGAGGCTGG + Intronic
1026037304 7:66838858-66838880 GCTACTTAGGAGACTGAGGCAGG + Intergenic
1026041679 7:66873374-66873396 GCTACTCAGGAGATTGAGGCAGG + Intergenic
1026070614 7:67116212-67116234 GCTACTTAGGAGACTGAGGCAGG + Intronic
1026165387 7:67904655-67904677 GATACTCAGGAGACTGAGGCAGG - Intergenic
1026324487 7:69297014-69297036 GACACTCAGGAGATTGAGGTGGG + Intergenic
1026342242 7:69444598-69444620 GATACTTAGGAGGCTGAGGCAGG - Intergenic
1026393362 7:69925904-69925926 GCTGCTTAGGAGATGGAGGTAGG + Intronic
1026476610 7:70741577-70741599 GCTACTTAGGAGACTGAGGCAGG + Intronic
1026613085 7:71878288-71878310 GCTACTTGGGAGGTGGAGGCAGG + Intronic
1026623735 7:71974304-71974326 GCTACTCAGGAGATTGAGGCAGG + Intronic
1026626066 7:71993566-71993588 GCTACTCAGGAGGTGGAGGCAGG - Intronic
1026649086 7:72199161-72199183 GTTACTTGGGAGGTGGAGGCAGG + Intronic
1026681689 7:72471909-72471931 GATACTTGGGAGATTAAGGCAGG - Intergenic
1026706282 7:72696057-72696079 GCTACTTAGGAGACTGAGGCAGG - Intronic
1026781751 7:73272771-73272793 GAGACTCAGGGGTGGGAGGCAGG - Intergenic
1026812886 7:73483751-73483773 GCTACTTTGGAGATGGAGGCAGG - Intronic
1026851077 7:73723566-73723588 GATACTTGGGAGGCGGAGGCAGG + Intergenic
1026855020 7:73747754-73747776 GCTACTTGGGAGGTGGAGGCAGG - Intergenic
1026892943 7:73993002-73993024 GCTACTCAGGAGACGGAGGCAGG - Intergenic
1026944779 7:74308614-74308636 GCTACTTGGGAGGTGGAGGCAGG - Intronic
1027002554 7:74663939-74663961 GCTACTTAGGAGACTGAGGCAGG - Intronic
1027022600 7:74826205-74826227 GAGACTCAGGGGTGGGAGGCAGG - Intronic
1027028141 7:74869415-74869437 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1027059612 7:75074664-75074686 GCTACTTAGGAGACTGAGGCAGG + Intergenic
1027065412 7:75119704-75119726 GAGACTCAGGGGTGGGAGGCAGG + Intronic
1027160168 7:75796680-75796702 GCTACTTAGGAGGTTGAGGCAGG - Intergenic
1027213582 7:76169198-76169220 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
1027609710 7:80345462-80345484 GAGACTCAGAAGGTGGAGGGTGG + Intergenic
1027816096 7:82974272-82974294 GCTACTTAGGAGGTTGAGGCAGG + Intronic
1027938167 7:84636081-84636103 GATACTCAGGAGACTGAGGCAGG - Intergenic
1028134274 7:87209984-87210006 GAGACAGAGGAGAGGGAGGGGGG + Intronic
1028204364 7:87998726-87998748 GAGACTTTGCAGATGGAATCAGG - Intronic
1028206483 7:88023529-88023551 GCTACTCAGGAGATTGAGGCAGG - Intronic
1028567606 7:92249606-92249628 GCTACTTGGGAGGTGGAGGCAGG + Intronic
1028601057 7:92600966-92600988 GCTGCTTAGGAGATTGAGGCAGG - Intergenic
1029471559 7:100757972-100757994 GATACTTGGGAGGTTGAGGCAGG + Intronic
1029524107 7:101084820-101084842 GATACTCAGGAGACTGAGGCAGG - Intergenic
1029663877 7:101981720-101981742 GCTACTCAGGAGACGGAGGCAGG - Intronic
1029859331 7:103552612-103552634 GTGACTTAGGAGGCTGAGGCAGG - Intronic
1029972076 7:104799672-104799694 GCAACTTAGGAGATGGAAGCAGG + Intronic
1030053726 7:105562789-105562811 GGTACTTAGGAGACTGAGGCAGG + Intronic
1030117485 7:106073114-106073136 GCTACTTAGGAGGCGGAGGCAGG + Intergenic
1030257387 7:107525829-107525851 GTTACTTGGGAGGTGGAGGCAGG - Intronic
1030278277 7:107743453-107743475 GAGACTTAAGAGATGGGAACCGG + Intergenic
1030734129 7:113024642-113024664 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1030930141 7:115512594-115512616 GTGCTTTAGGAGATGGAGGCAGG - Intergenic
1031112886 7:117632449-117632471 GCTACTTAGGAGACTGAGGCAGG + Intronic
1031170353 7:118285519-118285541 GCTACTCAGGAGATGGAGGTGGG + Intergenic
1032038857 7:128541605-128541627 GATACTCAGGAGGTTGAGGCAGG - Intergenic
1032059235 7:128710027-128710049 GCTACTCAGGAGATTGAGGCAGG - Intronic
1032122009 7:129163433-129163455 GAGACTTAGGAGATGGAGGCAGG - Intronic
1032221498 7:129998014-129998036 GCTACTTAGGAGGTTGAGGCAGG - Intergenic
1032282177 7:130512919-130512941 GAGAAAGAGAAGATGGAGGCTGG + Intronic
1032474763 7:132204193-132204215 GAGAGATAGGAGGTGGAGGGTGG + Intronic
1033068526 7:138179994-138180016 GACAAGTAGGAGAAGGAGGCTGG - Intergenic
1033084066 7:138326150-138326172 GCTACTTAGGAGGCGGAGGCAGG - Intergenic
1033317811 7:140313002-140313024 GAGACTCAGGAGGCTGAGGCAGG - Intronic
1033401563 7:141030486-141030508 GCTACTTGGGAGATTGAGGCAGG + Intergenic
1033468901 7:141625459-141625481 GCTACTTAGGAGGTGGAAGCAGG - Intronic
1033492471 7:141856945-141856967 GCTACTTGGGAGGTGGAGGCAGG + Intergenic
1033880676 7:145879763-145879785 GATACTCAGGAGACTGAGGCAGG - Intergenic
1034081086 7:148278221-148278243 CATACTTAGGAGGTGGATGCAGG + Intronic
1034183039 7:149153229-149153251 GCTACTTAGGAGGTTGAGGCAGG + Intronic
1034258796 7:149740957-149740979 GCTACTTGGGAGATTGAGGCAGG + Intergenic
1034280838 7:149853167-149853189 GATACTCCGGAGATGGAGGCAGG - Intronic
1034295281 7:149966971-149966993 GCTACTCAGGAGGTGGAGGCTGG - Intergenic
1034324336 7:150216872-150216894 GCTACTTAGGAGACTGAGGCAGG + Intergenic
1034346137 7:150386518-150386540 GGGACCTAGGAGAGGGAGTCTGG + Intronic
1034616587 7:152422903-152422925 GCTACTCAGGAGGTGGAGGCAGG + Intronic
1034768857 7:153752359-153752381 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1035130413 7:156647349-156647371 GAGACTCAGGAGGCGGAGGGTGG - Intronic
1035136698 7:156710014-156710036 GCTACTCAGGAGATTGAGGCAGG - Intronic
1035280779 7:157776696-157776718 GAGGCGGAGGAGAGGGAGGCAGG - Intronic
1035375634 7:158404990-158405012 GAGGCCGAGGAGCTGGAGGCTGG - Intronic
1035429437 7:158807429-158807451 GCGACTTATGAGAAGGAGGTCGG + Intronic
1036209368 8:6829761-6829783 GTGCTTTAGGAGGTGGAGGCAGG - Intronic
1036419657 8:8583823-8583845 GCTACTTCGGAGATTGAGGCAGG + Intergenic
1036526154 8:9536639-9536661 GCGACTTGGGAGACTGAGGCAGG + Intergenic
1036631046 8:10515363-10515385 GATACTCAGGAGGTTGAGGCAGG + Intergenic
1036819222 8:11926264-11926286 GCTGCTCAGGAGATGGAGGCAGG + Intergenic
1036970328 8:13347975-13347997 GCTACTTGGGAGGTGGAGGCAGG + Intronic
1036984889 8:13518218-13518240 GCTAGTCAGGAGATGGAGGCAGG - Intergenic
1037138133 8:15488388-15488410 GCTACTTAGGAGACTGAGGCTGG + Intronic
1037147638 8:15592529-15592551 GAGAGTTAGGAGGAGGTGGCAGG - Intronic
1037208832 8:16360313-16360335 GAGACTAAAGAGAGGGAGGAGGG + Intronic
1037622412 8:20576405-20576427 GAGACTATGGAGAAGTAGGCAGG + Intergenic
1037814749 8:22106220-22106242 GATACTTAGGAGGCTGAGGCAGG - Intergenic
1037830876 8:22188278-22188300 GCTACTCAGGAGATGGAGGTGGG - Intronic
1038016865 8:23522994-23523016 GCGACTTAGGAGGATGAGGCAGG - Intergenic
1038184696 8:25262928-25262950 AAAACTCAGGAGGTGGAGGCAGG - Intronic
1038292078 8:26258967-26258989 AACACTTAGGAGCTGGAGGTTGG - Intergenic
1038324818 8:26564924-26564946 GAGACTCAGAAGAAGGAGGGTGG - Intronic
1038462187 8:27726586-27726608 GCGACTTGGGAGACTGAGGCAGG + Intergenic
1038481034 8:27901942-27901964 GAAAATGGGGAGATGGAGGCTGG + Intronic
1038602629 8:28962018-28962040 GCTACTTAGGAGGTTGAGGCAGG - Intronic
1038690036 8:29753040-29753062 GCTACTTAGGAGTTTGAGGCAGG - Intergenic
1039708626 8:40033228-40033250 GATACTTGGGAGGCGGAGGCGGG - Intergenic
1039824871 8:41164401-41164423 GAACTTTGGGAGATGGAGGCGGG - Intergenic
1040065017 8:43138675-43138697 GCTACTTAGGAGGTTGAGGCAGG - Intergenic
1040577491 8:48666661-48666683 GCTACTTAGGAGACTGAGGCAGG + Intergenic
1040666628 8:49641685-49641707 GCTACTCAGGAGACGGAGGCTGG - Intergenic
1040713327 8:50216504-50216526 CAGACTTAGGGGATGAAAGCAGG + Intronic
1040852005 8:51910392-51910414 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
1041227194 8:55712385-55712407 TAGTGTTGGGAGATGGAGGCTGG - Intronic
1041606502 8:59788190-59788212 GAGAATTGGGAGATGGAGGCAGG - Intergenic
1042562916 8:70086671-70086693 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
1042666112 8:71208318-71208340 GCTACTTAGGAGACTGAGGCAGG + Intronic
1042839422 8:73108774-73108796 GCTACTCAGGAGGTGGAGGCAGG - Intronic
1042876417 8:73444292-73444314 GATACTCTGGAGGTGGAGGCAGG + Intronic
1043429894 8:80184717-80184739 GCTACTTGGGAGGTGGAGGCAGG - Intronic
1043481777 8:80660358-80660380 GCTACTTTGGAGATGGAGGCAGG + Intronic
1044188094 8:89280734-89280756 GTGTTTTAGGAGATGGAGGAGGG - Intergenic
1044463109 8:92470528-92470550 TTGACTTATGAGATGGAGGAGGG - Intergenic
1044647370 8:94458753-94458775 GCTACTTGGGAGATTGAGGCAGG + Intronic
1044647885 8:94463801-94463823 GCTACTTAGGAGATGGAGGTGGG + Intronic
1044843213 8:96355699-96355721 GAGCTTTGGGAGGTGGAGGCAGG + Intergenic
1044847113 8:96392695-96392717 GCTACTTGGGAGGTGGAGGCAGG + Intergenic
1044963380 8:97552771-97552793 GCTACTTGGGAGGTGGAGGCAGG + Intergenic
1044985616 8:97753970-97753992 GCCACTTGGGAGATTGAGGCAGG + Intergenic
1045033984 8:98163211-98163233 GATACTTAGGAGGCTGAGGCAGG - Intergenic
1045124549 8:99074745-99074767 GCTACTCAGGAGATTGAGGCAGG - Intronic
1045301588 8:100915710-100915732 GCTACTTGGGAGATTGAGGCAGG + Intergenic
1045366364 8:101479745-101479767 GCTACTTAGGAGGTTGAGGCAGG - Intergenic
1045808173 8:106190326-106190348 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
1046273448 8:111925855-111925877 GCTACTTAGGAGGCGGAGGCAGG + Intergenic
1047025052 8:120814875-120814897 GCTACTTGGGAGATGGAGGCAGG + Intergenic
1047222276 8:122928130-122928152 GAGATGGAGGAGATGGAGCCTGG - Intronic
1047348778 8:124053744-124053766 GCTACTCAGGAGGTGGAGGCGGG + Intronic
1047869578 8:129067972-129067994 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1048069098 8:131003087-131003109 GCTACTTGGGAGGTGGAGGCAGG + Intronic
1048322432 8:133410583-133410605 GGTCCTTAGGAGAGGGAGGCAGG + Intergenic
1048341936 8:133546892-133546914 GAGACTCAGGAGTCTGAGGCAGG + Intronic
1048436946 8:134427128-134427150 GTGACTTGGGAGGTTGAGGCAGG - Intergenic
1048712072 8:137223601-137223623 GCTACTTGGGAGGTGGAGGCAGG + Intergenic
1048922087 8:139240511-139240533 GATACTCAGGAGACTGAGGCAGG - Intergenic
1049150083 8:141029474-141029496 GCTACTTGGGAGGTGGAGGCAGG + Intergenic
1049439755 8:142603926-142603948 GACCCTTAGGAGATGGGGACGGG + Intergenic
1049512322 8:143035184-143035206 GCTACTTAGGAGGTTGAGGCGGG - Intergenic
1049588765 8:143445267-143445289 GCTACTCAGGAGATTGAGGCAGG + Intronic
1049946832 9:605187-605209 GCTACTTAGGAGACTGAGGCAGG + Intronic
1049986719 9:958611-958633 GAGAGTTAGGAGGTCCAGGCGGG - Intronic
1050022550 9:1299669-1299691 GAGACTCAGGAGGCTGAGGCAGG - Intergenic
1050349708 9:4729120-4729142 GCTACTCAGGAGGTGGAGGCAGG - Intronic
1050411654 9:5372693-5372715 GAGACTTGGGAGGTGGAAGTGGG - Intronic
1050427499 9:5526547-5526569 GCTACTCAGGAGATTGAGGCAGG - Intronic
1050519984 9:6487476-6487498 GCTACTCAGGAGGTGGAGGCAGG - Intronic
1050559199 9:6817311-6817333 GCTACATAGGAGGTGGAGGCAGG - Intronic
1051027935 9:12636362-12636384 GCTACTTAGGAGACTGAGGCAGG + Intergenic
1051075102 9:13223920-13223942 GATACTCAGGAGACTGAGGCAGG + Intronic
1051644608 9:19255154-19255176 GTGGCTCAGGAGGTGGAGGCTGG + Intronic
1051798438 9:20903147-20903169 GATTGTTAGGAGATGGAGGTGGG - Intronic
1052749510 9:32475061-32475083 GATACTTGGGAGACTGAGGCAGG - Intronic
1052750236 9:32482745-32482767 GCTACTTAGGAGACTGAGGCAGG + Intronic
1052889459 9:33684757-33684779 GACACTTTGAAGATGGAGGAAGG + Intergenic
1052929194 9:34042364-34042386 GCTACTCGGGAGATGGAGGCTGG + Intronic
1052937185 9:34102539-34102561 GATACTTAGGAGGCTGAGGCAGG + Intronic
1053028380 9:34751251-34751273 GATACTTGGGAGGTTGAGGCAGG + Intergenic
1053170255 9:35873675-35873697 GCTACTTGGGAGATTGAGGCAGG + Intergenic
1053194622 9:36106992-36107014 GATACTCAGGAGACTGAGGCAGG + Intronic
1053576196 9:39358687-39358709 GAGACCTACCAGATGGAAGCTGG + Exonic
1053865415 9:42432891-42432913 GCTACTTAGGAGGCGGAGGCAGG + Intergenic
1054749009 9:68885673-68885695 AAGACTTAGAAGAGGGAGGGTGG + Intronic
1054762936 9:69019498-69019520 GCTACTTAGGAGACTGAGGCAGG + Intergenic
1054984621 9:71247240-71247262 GTTACTCAGGAGATTGAGGCAGG + Intronic
1055104693 9:72500184-72500206 GCTACTTGGGAGGTGGAGGCAGG + Intergenic
1055297800 9:74852301-74852323 GCTACTCAGGAGATTGAGGCTGG - Intronic
1055304295 9:74912839-74912861 GCTACTTAGGAGACTGAGGCAGG + Intergenic
1055437600 9:76308083-76308105 GCTACTTGGGAGATTGAGGCAGG + Intronic
1055473082 9:76633108-76633130 GCTACTTGGGAGGTGGAGGCAGG + Intronic
1055655406 9:78445983-78446005 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1056039093 9:82642346-82642368 GAGACTCAGGAAACTGAGGCAGG + Intergenic
1056987010 9:91372731-91372753 GCTACTCAGGAGATAGAGGCAGG + Intergenic
1057137162 9:92700211-92700233 GAGACTCAGGAGGCTGAGGCAGG + Intergenic
1057357427 9:94343395-94343417 GATACTCAGGAGACTGAGGCAGG + Intergenic
1057612711 9:96560692-96560714 GCGACTTGGGAGAATGAGGCAGG - Intronic
1057777484 9:98022618-98022640 GTGACTCAGGAGACTGAGGCCGG - Intergenic
1058371406 9:104271786-104271808 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
1058433269 9:104938189-104938211 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1058762261 9:108146571-108146593 GCTACTTAGGAGGTTGAGGCAGG - Intergenic
1058945307 9:109850132-109850154 GAGGCTTTGGAGATGGATGCAGG + Intronic
1058965507 9:110034267-110034289 GCTACTTAGGAGACTGAGGCAGG - Intronic
1059020399 9:110570590-110570612 GCTACTTGGGAGACGGAGGCAGG - Intronic
1059235896 9:112760474-112760496 GAGATTTATGAGATGGATGATGG + Intronic
1059547035 9:115187138-115187160 GCCACTCAGGAGGTGGAGGCAGG - Intronic
1059828140 9:118057118-118057140 GCTACTCAGGAGATGGAGGCTGG - Intergenic
1059855782 9:118396045-118396067 GCGACTCAGGAGGTTGAGGCAGG - Intergenic
1060127845 9:121067154-121067176 GTTACTCAGGAGATTGAGGCAGG + Intergenic
1060317366 9:122525044-122525066 TAGACTAAGGAGATGAGGGCAGG + Intergenic
1060396087 9:123318019-123318041 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
1060483026 9:124028996-124029018 GCCACTCAGGAGATTGAGGCAGG + Intronic
1060498186 9:124133240-124133262 GAGACTCAAGAGATGGAGTGAGG + Intergenic
1060565768 9:124589951-124589973 GCTACTCAGGAGATTGAGGCAGG + Intronic
1060798133 9:126526469-126526491 AAGCCTCAGGAGCTGGAGGCTGG + Intergenic
1060951254 9:127604861-127604883 GCTACTTAGGAGACTGAGGCAGG + Intergenic
1061118986 9:128631713-128631735 GCTACTCAGGAGATTGAGGCAGG + Intronic
1061186140 9:129055001-129055023 GCTACTTAGGAGGTTGAGGCAGG - Intronic
1061186340 9:129056628-129056650 GCGACTTGGGAGACTGAGGCAGG - Intronic
1061209708 9:129183722-129183744 GAGACTGGGGGGATGGGGGCTGG + Intergenic
1061500723 9:131000334-131000356 GAGATTTAGAAGATGGAAGTGGG - Intergenic
1062135835 9:134927454-134927476 GCTACTTAGGAGGTTGAGGCAGG + Intergenic
1062228272 9:135465990-135466012 GGGAGAAAGGAGATGGAGGCAGG + Intergenic
1062296979 9:135835866-135835888 GCTACTTGGGAGATTGAGGCAGG + Intronic
1062737543 9:138145885-138145907 GCTACTTGGGAGGTGGAGGCAGG - Intergenic
1185460803 X:332085-332107 GAGACAGAGGAGATGGAGAGGGG - Intergenic
1185675843 X:1848970-1848992 GCTACTTGGGAGATGGTGGCAGG - Intergenic
1185757487 X:2663234-2663256 GCTACTCAGGAGATTGAGGCAGG + Intergenic
1185777677 X:2818357-2818379 GCTACTTAGGAGGTTGAGGCAGG + Intergenic
1186139837 X:6560304-6560326 GCTACTTAGGAGGCGGAGGCAGG - Intergenic
1186285527 X:8039788-8039810 GCTACTCAGGAGGTGGAGGCAGG - Intergenic
1186382284 X:9073587-9073609 GATACTTAGGAGGCTGAGGCAGG - Intronic
1186665976 X:11717817-11717839 GCTACTTAGGAGGTTGAGGCAGG + Intergenic
1187045886 X:15647168-15647190 GAGGCTCAGGAGGTGGTGGCAGG - Intronic
1187051864 X:15703469-15703491 GAGGCTCAGGAGGTGGTGGCAGG - Intronic
1187073445 X:15911270-15911292 GCAACTTGGGAGGTGGAGGCAGG - Intergenic
1187192171 X:17045429-17045451 AAGACTTTGGAGATGTAAGCGGG - Intronic
1187435536 X:19265401-19265423 GAGACTCAGAAGGTGGAGGGTGG - Intergenic
1187952760 X:24486740-24486762 GCTACTTAGGAGACTGAGGCAGG - Intronic
1188269541 X:28121659-28121681 GCTACTTAGGAGATTGAAGCAGG - Intergenic
1188320638 X:28732755-28732777 GCTACTTAGGAGACTGAGGCAGG + Intronic
1188397624 X:29704555-29704577 GATACTCAGGAGACTGAGGCAGG + Intronic
1189335231 X:40167053-40167075 GATATTTTGGAGATGGAGGGAGG - Intronic
1189381200 X:40503590-40503612 GAGACTCAGGAGTCTGAGGCAGG + Intergenic
1189486173 X:41434237-41434259 GCTACTTAGGAGGTTGAGGCAGG - Intergenic
1189832985 X:44993752-44993774 GCTACTTAGGAGACTGAGGCAGG + Intronic
1190075735 X:47315792-47315814 GATACTCAGGAGGTTGAGGCGGG + Intergenic
1190095109 X:47473133-47473155 GCGACTTAGGAGGCTGAGGCAGG - Intronic
1190190055 X:48269484-48269506 GCGACTCTGGAGATTGAGGCAGG - Intronic
1190746785 X:53328489-53328511 GCTACTTAGGAGACTGAGGCAGG + Intergenic
1190771277 X:53516793-53516815 TAGTGTTGGGAGATGGAGGCTGG - Intergenic
1190837102 X:54111107-54111129 GCTACTTAGGAGACTGAGGCGGG + Intronic
1190885283 X:54526216-54526238 GCTACTTGGGAGGTGGAGGCAGG + Intergenic
1190974231 X:55384215-55384237 GTTACTCAGGAGGTGGAGGCAGG + Intergenic
1191681595 X:63846357-63846379 GAGACTTGGGAAATGAAGCCAGG + Intergenic
1191996821 X:67104698-67104720 GGGACTTAGGAGATGGATTTGGG + Intergenic
1192110927 X:68363419-68363441 GATACTTGGGAGACTGAGGCAGG - Intronic
1193260628 X:79403013-79403035 GATACTTAGGAGGCTGAGGCAGG + Intergenic
1194091401 X:89584312-89584334 CAGCCTAAGGAGATGGAGCCCGG + Intergenic
1194290710 X:92068649-92068671 GCTACTTGGGAGACGGAGGCTGG - Intronic
1194371529 X:93079053-93079075 GATACTTGGGAGGTTGAGGCAGG + Intergenic
1194699186 X:97092936-97092958 GTGCCTTGGGAGGTGGAGGCAGG + Intronic
1195110142 X:101639946-101639968 GAAATTTAGGAGAGGGAGGAGGG + Intergenic
1195376781 X:104235412-104235434 GCTACTTGGGAGATTGAGGCGGG - Intergenic
1195584936 X:106553861-106553883 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
1196302717 X:114064944-114064966 GCTACTTGGGAGGTGGAGGCAGG + Intergenic
1196465622 X:115969088-115969110 GAGACACAGAAGATGGAGGGAGG - Intergenic
1196648062 X:118139601-118139623 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1196719958 X:118844343-118844365 GCTACTTAGGAGACTGAGGCAGG + Intergenic
1197139971 X:123106752-123106774 GATACTCAGGAGGTTGAGGCAGG + Intergenic
1197667242 X:129237256-129237278 GATACTTGGGAGGTTGAGGCAGG + Intergenic
1197738463 X:129870805-129870827 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1198129919 X:133683328-133683350 AAGGCTTAGGAGATGGAACCAGG - Intronic
1198254299 X:134912159-134912181 GCTACTCAGGAGGTGGAGGCAGG - Intronic
1198273432 X:135077702-135077724 GAGCAATAGGAGTTGGAGGCAGG - Intergenic
1198454012 X:136797494-136797516 GCTACTTGGGAGGTGGAGGCTGG - Intergenic
1198608502 X:138371322-138371344 GCGACTTGGGAGACTGAGGCAGG + Intergenic
1199188740 X:144945935-144945957 GAGATTTATGAGATAAAGGCAGG - Intergenic
1200055808 X:153460028-153460050 GAGACCTGGGAGTTGGAGGAGGG - Intronic
1200083300 X:153590114-153590136 GTTACTTAGGAGACTGAGGCAGG + Intronic
1200155015 X:153970590-153970612 GAGAGGGAGGAGATGGAGGGAGG + Intronic
1200205454 X:154312265-154312287 GCTACTTAGGAGGCGGAGGCGGG + Intronic
1200245048 X:154518799-154518821 GCTACTTAGGAGACTGAGGCAGG - Intergenic
1200608222 Y:5293239-5293261 GCTACTTGGGAGACGGAGGCTGG - Intronic
1200765858 Y:7080184-7080206 GTTACTTGAGAGATGGAGGCAGG - Intronic
1200794409 Y:7327624-7327646 GATACTCAGGAGACTGAGGCAGG - Intergenic
1201183316 Y:11371375-11371397 GATACTTGGGAGGTTGAGGCAGG + Intergenic
1201322416 Y:12714748-12714770 TAGATTTAACAGATGGAGGCCGG - Intronic
1201565654 Y:15362995-15363017 GCTACTTGGGAGATTGAGGCAGG - Intergenic
1201968620 Y:19766829-19766851 GCTACTCAGGAGGTGGAGGCAGG + Intergenic
1202098163 Y:21276148-21276170 TAGACTTAGCTTATGGAGGCTGG - Intergenic
1202168274 Y:22015206-22015228 GGGACTTGGGAGATGGAGCCCGG - Intergenic
1202223087 Y:22571162-22571184 GGGACTTGGGAGATGGAGCCCGG + Intergenic
1202320028 Y:23624498-23624520 GGGACTTGGGAGATGGAGCCCGG - Intergenic
1202550740 Y:26045558-26045580 GGGACTTGGGAGATGGAGCCCGG + Intergenic
1202588822 Y:26460825-26460847 GATACTTGGGAGGCGGAGGCAGG - Intergenic
1202592672 Y:26503764-26503786 TGGGCTTTGGAGATGGAGGCAGG + Intergenic