ID: 1032122857

View in Genome Browser
Species Human (GRCh38)
Location 7:129169304-129169326
Sequence GCAGGCGGGGCGGGCGCGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 7, 3: 55, 4: 367}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032122850_1032122857 -5 Left 1032122850 7:129169286-129169308 CCGGGAGGAGCGCGCGAGGCAGG No data
Right 1032122857 7:129169304-129169326 GCAGGCGGGGCGGGCGCGTCCGG 0: 1
1: 0
2: 7
3: 55
4: 367
1032122848_1032122857 2 Left 1032122848 7:129169279-129169301 CCTGGCGCCGGGAGGAGCGCGCG 0: 1
1: 1
2: 2
3: 29
4: 251
Right 1032122857 7:129169304-129169326 GCAGGCGGGGCGGGCGCGTCCGG 0: 1
1: 0
2: 7
3: 55
4: 367
1032122847_1032122857 5 Left 1032122847 7:129169276-129169298 CCTCCTGGCGCCGGGAGGAGCGC 0: 1
1: 0
2: 1
3: 11
4: 136
Right 1032122857 7:129169304-129169326 GCAGGCGGGGCGGGCGCGTCCGG 0: 1
1: 0
2: 7
3: 55
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032122857 Original CRISPR GCAGGCGGGGCGGGCGCGTC CGG Intronic