ID: 1032122857

View in Genome Browser
Species Human (GRCh38)
Location 7:129169304-129169326
Sequence GCAGGCGGGGCGGGCGCGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 7, 3: 55, 4: 367}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032122848_1032122857 2 Left 1032122848 7:129169279-129169301 CCTGGCGCCGGGAGGAGCGCGCG 0: 1
1: 1
2: 2
3: 29
4: 251
Right 1032122857 7:129169304-129169326 GCAGGCGGGGCGGGCGCGTCCGG 0: 1
1: 0
2: 7
3: 55
4: 367
1032122847_1032122857 5 Left 1032122847 7:129169276-129169298 CCTCCTGGCGCCGGGAGGAGCGC 0: 1
1: 0
2: 1
3: 11
4: 136
Right 1032122857 7:129169304-129169326 GCAGGCGGGGCGGGCGCGTCCGG 0: 1
1: 0
2: 7
3: 55
4: 367
1032122850_1032122857 -5 Left 1032122850 7:129169286-129169308 CCGGGAGGAGCGCGCGAGGCAGG 0: 1
1: 0
2: 1
3: 22
4: 229
Right 1032122857 7:129169304-129169326 GCAGGCGGGGCGGGCGCGTCCGG 0: 1
1: 0
2: 7
3: 55
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032122857 Original CRISPR GCAGGCGGGGCGGGCGCGTC CGG Intronic
900117286 1:1034082-1034104 GCAGGAGGGGCGGCCGCGTCGGG - Intronic
900183995 1:1324625-1324647 GCAGGCGGGCCTCGCGGGTCCGG - Exonic
900212026 1:1460843-1460865 GCAGGAGGAGCGGGCGCGCCTGG + Exonic
900217676 1:1490350-1490372 GCAGGAGGAGCGGGAGCGCCTGG + Exonic
900284046 1:1890839-1890861 GGCGGCGGTGTGGGCGCGTCAGG - Exonic
900314555 1:2050436-2050458 GCGCGCGGGGCGGGACCGTCCGG - Intergenic
900414697 1:2529581-2529603 GCGGGCGCGGCGGGCGCGGCCGG + Exonic
900992932 1:6106333-6106355 GCAGGCAGGCCGGGCCCGGCGGG + Intronic
901676598 1:10889101-10889123 CCAGCCGGGGCGGGCGTGCCGGG - Intergenic
902323466 1:15683976-15683998 GCAGGCGGGGTCGGGGTGTCCGG + Intergenic
902444386 1:16452759-16452781 GCGGGCGGGGGGGGCGCGCGGGG - Intronic
904023897 1:27490114-27490136 ACAGGCAGGGCGAGCGCGGCTGG - Exonic
904494004 1:30876721-30876743 GTGGGCGGGGAGGGCGCCTCGGG + Exonic
904826456 1:33276604-33276626 GCGGGCGGGGCCGGCGGGGCCGG + Intronic
905308453 1:37034289-37034311 CCAGGCGGGGCGGGCGCCGGCGG - Intergenic
905656961 1:39691570-39691592 GCAGGCGGGGCGCGCTCCTGCGG - Exonic
905912252 1:41662706-41662728 GGAGCCGGGGCGGGCGCGGAGGG - Intronic
906320626 1:44813370-44813392 GCAGGCGGTGCTGGAGCGGCCGG + Exonic
906520932 1:46466545-46466567 GCCGGCGGCGCGGGGGCGCCTGG - Intergenic
907160542 1:52365990-52366012 GGAGGCGGCGCGGGCGGGGCAGG - Intronic
907188988 1:52633258-52633280 GCAGGCGGGGCGGGCGGCGGGGG - Intergenic
910231986 1:84997139-84997161 GGGGGCGGGGCGGGAGCGCCTGG - Intergenic
910963343 1:92784693-92784715 GGGAGCGGGGCGGGCGCGCCTGG - Intronic
912381309 1:109249636-109249658 GCGGGCGGCGCGGGACCGTCGGG + Intergenic
913252289 1:116921871-116921893 GCAGGTGGGGCTGGAGAGTCGGG + Intronic
914345395 1:146794496-146794518 GAAGGCGGAGCGGGAGCGCCTGG + Intergenic
915246334 1:154558577-154558599 GCCGGCGGGCCGGGAGCCTCCGG + Exonic
920190422 1:204190415-204190437 GCATGCGGGGCGGGGGCGGGGGG - Exonic
921324886 1:213980211-213980233 ACAGGCGGGGAGGGGGCGTGTGG - Intergenic
922570643 1:226632953-226632975 GCAGGCAGGACGGGGGCGTTGGG - Exonic
922695309 1:227728424-227728446 GCAGGCGGGGCAGGCAGGGCGGG - Intergenic
922917649 1:229271384-229271406 GCTGGCGGGGCGCGCGGGTCGGG + Intronic
924502855 1:244653165-244653187 GCAGCCGGGGCGGAAGCATCGGG - Exonic
924944774 1:248838715-248838737 GCAGGCCGCGCGGACGTGTCCGG - Intronic
1062874216 10:931977-931999 GCGGGCGGGGCGGGCGGGGCGGG - Intergenic
1062982630 10:1737720-1737742 GGACGCGGCGCGGGTGCGTCTGG + Intergenic
1063504058 10:6580294-6580316 GCTGGCGGGGCTGGCGGGGCTGG + Exonic
1063504062 10:6580303-6580325 GCTGGCGGGGCTGGCGGGGCTGG + Intergenic
1063504065 10:6580312-6580334 GCTGGCGGGGCTGGCGGGCCCGG + Intergenic
1064059977 10:12129486-12129508 GGAGGCGGGGCTGGCGCGCCTGG - Intergenic
1065024383 10:21526604-21526626 CCAGGCGGGGGAGGCGCGGCGGG - Intergenic
1067462172 10:46465977-46465999 GCAGGCTGGGCGGGCGCAGGCGG - Intergenic
1067625024 10:47918621-47918643 GCAGGCTGGGCGGGCGCAGGCGG + Intergenic
1069186538 10:65429676-65429698 GCCGGCGGGGCTGGCGGGGCAGG + Intergenic
1070398910 10:76035833-76035855 GGAGTCGGGGCGGGGGCGGCGGG - Intronic
1073057884 10:100713888-100713910 GCGGGCGGAGCGGGGGCGCCCGG - Intergenic
1073207463 10:101776370-101776392 GCGGGAGGGGCGGGGGCGGCCGG + Intronic
1074088395 10:110226028-110226050 GCGGGCGCGGCTGGCGCGGCTGG + Intronic
1074102610 10:110365382-110365404 GTAGGCGGGGAGGGAGCATCAGG - Intergenic
1075438382 10:122461394-122461416 GGGGGCAGGGCGGGCGCGCCCGG - Intergenic
1076707018 10:132307750-132307772 GCCGGCGGGGCGCGCGCGGCCGG + Exonic
1076985979 11:236369-236391 GGAGGCGGGGCCGGGGCGCCGGG - Exonic
1076985999 11:236408-236430 GGAGGCGGGGCTGGGGCGCCGGG - Exonic
1077093531 11:789988-790010 GCGGGCGGGGCGGGCGGGGCGGG - Intronic
1077299622 11:1840960-1840982 GCAGGCGGGGCGGGCCGGGGAGG + Intronic
1077419936 11:2445297-2445319 GGGGGCGCGGCGGGCGCGGCCGG - Exonic
1077476066 11:2791181-2791203 GCAGGCGGCAGGGGCGTGTCAGG + Intronic
1078225200 11:9385101-9385123 TGAGGCGGGGCGGGCGTGACGGG + Intronic
1079128517 11:17734916-17734938 GGAGGCGGGGGTGGCGGGTCCGG - Exonic
1081488228 11:43547818-43547840 GCCGGAGGGGCGGGCGCCTAGGG - Intergenic
1081491876 11:43575613-43575635 GCAGGCGAGGCGGCCGAGGCGGG - Intronic
1081630292 11:44684954-44684976 GCAGGCGGGGAGGCCTCCTCAGG - Intergenic
1081705611 11:45180756-45180778 GCGGCCGGGGCGGGCGCGGGCGG - Intronic
1081943763 11:46969238-46969260 GCAGGAGGGGCGGGGGCTTCAGG - Intronic
1083719582 11:64597769-64597791 GCAGGCGGGGCGGGACGGTGTGG + Intronic
1083750729 11:64759296-64759318 GCAGGCGGGGCTGGGGCAGCTGG - Intronic
1084267149 11:68010902-68010924 GCAGGCGGGGCGGGGCTGGCTGG - Intronic
1084336347 11:68460279-68460301 CCGGGCGGGGCGGGGGCGGCGGG - Intergenic
1084476890 11:69394338-69394360 GCTGGTGGGGCCGGAGCGTCTGG + Intergenic
1088259278 11:107928856-107928878 GCCGGCGGGGCGGACGCCTGGGG - Intronic
1089459737 11:118645519-118645541 GCCTGCGGGGCGGGAGCGTGGGG + Exonic
1090048654 11:123358497-123358519 CCAGGCGGGGCGGGAGCCGCTGG - Intergenic
1092654879 12:10673931-10673953 GTATGGGGGGCGGGCGCGGCGGG - Intronic
1094041522 12:26125136-26125158 CCGGGCCGGGCGGGGGCGTCGGG + Intronic
1096981213 12:55729018-55729040 GCAGGCGGGGCGGGAGCCGGGGG - Intronic
1098369207 12:69739116-69739138 CCAGGAGGGGCGGCCGCGGCAGG + Intronic
1098425842 12:70365734-70365756 GCTGGCGGCGTGGGCGCGGCTGG + Intergenic
1100260512 12:92928859-92928881 GCGGGTGGGGCCGGCGCGGCGGG - Intronic
1101593114 12:106139882-106139904 GCTGGCAGGGTGGGCGCCTCTGG - Exonic
1102457088 12:113077647-113077669 GGCGGCGGCGCCGGCGCGTCTGG - Exonic
1102457168 12:113077960-113077982 GGAGGCGGCGCGGGCTCGGCGGG - Exonic
1103407719 12:120687396-120687418 GCCGGCGTGGCCGGCGCGGCGGG + Exonic
1103509861 12:121467010-121467032 GCCGGCGGGGCGGCCGGGGCCGG - Intronic
1103749779 12:123150867-123150889 GCAGGCGGCGGGGGCGCGCGGGG - Intergenic
1103764656 12:123271630-123271652 GCGGGCGCGCCGGGCGCGGCGGG + Exonic
1103764724 12:123271864-123271886 GCCGGCGGGGCGGCCGGGGCCGG + Exonic
1103800375 12:123533819-123533841 GGAGCCGGGCCGGGCGCCTCGGG + Intergenic
1103907925 12:124336830-124336852 GCAGGTGGCGCCGGCGGGTCCGG + Exonic
1103918727 12:124388773-124388795 GCAGGCTGGGCGGCCGCGGTCGG + Intronic
1104854340 12:131894976-131894998 GCAGGCGGGCCGGGGGCGCGGGG - Exonic
1104886292 12:132110875-132110897 GCCGGCAGGGCTGGCGCCTCTGG + Intronic
1104980877 12:132572638-132572660 GCAGGTGGGGCGGGCACAGCGGG + Intronic
1105472108 13:20703816-20703838 GCAGGCGGGGAGGGCGCTCTGGG + Intronic
1105472286 13:20704380-20704402 GCAGGCGGGGAGGGTGGGGCGGG + Intronic
1106109029 13:26760787-26760809 GTGGGCCGGGCGGGCGCGGCGGG - Intergenic
1108541684 13:51452325-51452347 GCGGCCGGGGCGGGGGTGTCGGG - Intronic
1110318605 13:74135574-74135596 GCAGACGGGGCGGAAGCGGCCGG + Intergenic
1112461434 13:99606670-99606692 AAGGGCGGGGCGCGCGCGTCGGG + Exonic
1113794767 13:113050710-113050732 GCAGGGGGGGCGGGGGCGGGGGG + Intronic
1114485224 14:23057827-23057849 GCTGGCGGGGCGGGTGCACCCGG + Intergenic
1116916676 14:50532353-50532375 GCTGGCGGGGAGGCCTCGTCGGG - Intronic
1117383823 14:55191781-55191803 GCAGTCGGGGCGCTCACGTCAGG + Intergenic
1117424485 14:55580437-55580459 GCAGGCGGGAGGGCCGCGCCGGG + Intronic
1118849461 14:69573012-69573034 GCACGCGGCGCGGGCGAGGCCGG + Exonic
1119236810 14:73026806-73026828 GAAGGGGGGGCGGGTGCGGCGGG - Intronic
1122545031 14:102517287-102517309 CCCGGCGGGGCGGGCGAGGCAGG + Intergenic
1122634413 14:103123392-103123414 GAAGGAGGGGCGGGCGGGGCGGG + Intergenic
1122688772 14:103521986-103522008 GCGGGCCGGGCGGGCGGGGCCGG - Intronic
1122750443 14:103928732-103928754 GCGGGCGGGGCGGAGGCGGCTGG + Intronic
1122975048 14:105167619-105167641 CCAGGCGGGGCGGGGCCGGCAGG - Intronic
1123994197 15:25706833-25706855 TGAGGCTGGGCGGGCACGTCTGG + Intronic
1125535869 15:40441066-40441088 TCGGGGGGGGCGGGCGCGCCTGG - Intronic
1126109482 15:45167145-45167167 CCAGCCGGGGCGGGGGCGGCGGG + Intergenic
1127982705 15:64046332-64046354 GCAGGCGCGGCGGGAGCGGCGGG + Intronic
1127982708 15:64046341-64046363 GCGGGAGCGGCGGGCGCGGCGGG + Intronic
1127982711 15:64046350-64046372 GCGGGCGCGGCGGGCGCGGCGGG + Intronic
1127982714 15:64046359-64046381 GCGGGCGCGGCGGGCGCGGCGGG + Intronic
1127982717 15:64046368-64046390 GCGGGCGCGGCGGGCGCGGCGGG + Intronic
1129220720 15:74130199-74130221 GCAGGCGGGGCGGGGGGGTTGGG + Intronic
1129220797 15:74130599-74130621 GCTGGCGGGACAGGCGCGTGAGG + Exonic
1129540258 15:76342572-76342594 GCGGGCGGGGCGGGCCCGGTGGG + Intergenic
1129780177 15:78264732-78264754 GCGGGGGGGGCGGGCGAGGCCGG - Intronic
1130010796 15:80152326-80152348 GCAGCCGGGGCGAGCGAGGCTGG + Intergenic
1130076579 15:80695246-80695268 GGAGGCGGGGCCGGCCCGGCGGG - Intronic
1131055337 15:89371529-89371551 GGGCGCGGGGCGGGCGCGTTTGG - Intergenic
1131108576 15:89750570-89750592 GCAGGCGGGTCGCGCGGCTCGGG + Exonic
1132055477 15:98648234-98648256 GCGGGAGGGGAGGGCGCGTGCGG + Intergenic
1132314379 15:100879667-100879689 GCAGGGGCGGCGGGCGGGGCGGG + Exonic
1132482251 16:172597-172619 GCTGGCGGGGCCGGCCCGTTGGG - Intergenic
1132483099 16:176401-176423 GCTGGCGGGGCCGGCCCGTTGGG - Intergenic
1132533839 16:467509-467531 GGAGGAGGTGCGGGGGCGTCAGG + Intronic
1132570611 16:642361-642383 GCAGGCGGGGCGGGCGCTCCGGG + Intronic
1132586045 16:706087-706109 GCGGGCGGGGAGGGCGCGGGAGG + Intronic
1132719681 16:1309610-1309632 GCGGGCGGGGCGCGCGGGGCGGG - Intronic
1132805030 16:1771418-1771440 GCAGGCGGGGACGGGCCGTCAGG + Intronic
1132880436 16:2159673-2159695 GCAGGCGGGGCGGAGGCTTCTGG + Intronic
1132925952 16:2429255-2429277 GCAGGCGGGGAGGGCGTGGAGGG + Intergenic
1132934709 16:2474608-2474630 GCGGGCTGGGCGTCCGCGTCCGG + Intergenic
1133097662 16:3458243-3458265 GTAGGCGGGGAGGCCGCGCCGGG + Intronic
1133097683 16:3458315-3458337 GCCGGGGGCGCGGGCGCGGCCGG - Intronic
1133219986 16:4315825-4315847 CCAGGCGGGGCGTGCGCGTCGGG - Intronic
1133234435 16:4381369-4381391 GCAGGCGGGGCAGGCGCAGCGGG - Exonic
1136136248 16:28258569-28258591 GCTGGCAGGGCGGGCGGGTGCGG - Intergenic
1136399763 16:30010946-30010968 GCAGGCTGGGCGGCGGCGGCCGG + Exonic
1137655131 16:50153151-50153173 GGGGGCGGGGCGAGCGCGTGAGG + Intronic
1139511673 16:67431461-67431483 GCAGGCGCTGCGGGCGCGCCAGG - Exonic
1139546741 16:67653200-67653222 GCTGGCGGCGCGGCCGCGGCCGG - Exonic
1139988592 16:70920767-70920789 GAAGGCGGAGCGGGAGCGCCTGG - Exonic
1140927575 16:79599181-79599203 GGAGGCGGCGGGGGCGCGGCGGG - Exonic
1141116691 16:81315329-81315351 GGAGGCGGGGCGGCCGGGCCGGG + Intronic
1141682586 16:85553268-85553290 GCAAGCGGGGCGGCGGGGTCGGG - Intergenic
1142136347 16:88453561-88453583 GCGGGCGGCGGGGGCGCGGCGGG - Exonic
1142285826 16:89171218-89171240 GAAGGCAGGGTGGGTGCGTCCGG - Intergenic
1142509358 17:384815-384837 GCTGGCGGGGAGGGGGCGGCTGG + Intronic
1142795435 17:2303584-2303606 GGAGGCGGGGCGGGCAGGCCCGG + Intronic
1142980561 17:3668755-3668777 GCAGGCGCGGAGGGCGGGGCGGG + Intronic
1144724959 17:17497058-17497080 GCAGGCGGGTGGGGAGCGGCAGG + Intergenic
1145110263 17:20156097-20156119 GCTGGCGAGGCGGTTGCGTCCGG - Intronic
1146058670 17:29593463-29593485 GCGGGCGGGGGCGGCGCGCCCGG - Exonic
1146256013 17:31391856-31391878 GCGGGCGGCGCGGGCTGGTCGGG + Exonic
1146632577 17:34481481-34481503 GCAGGCGGGGCAGGCCTGCCTGG - Intergenic
1147230224 17:39012291-39012313 GCAGTCGGGGCGAGCGCTTTTGG - Intergenic
1147648826 17:42050524-42050546 GCGGACGGGGCGGGGGCGCCAGG - Intronic
1148122754 17:45222267-45222289 GGAGGCGGGTCGGGCGCGGGCGG + Intronic
1148493470 17:48037819-48037841 GGAGGCGGGGCGGCGGCGGCGGG - Intronic
1148782500 17:50129753-50129775 GCAGGAGGCGCGGGCGGGGCTGG + Exonic
1149610265 17:57954570-57954592 GCCGGCGGGGCGGGCGAGCAGGG + Intronic
1150373664 17:64662371-64662393 GGAGGCGGGGCCGGCGGGGCGGG + Intergenic
1150643550 17:66964853-66964875 GGAGGGCGGGCGGGCGCGGCGGG + Intergenic
1150790603 17:68198182-68198204 GGGGGCGGGGCGGGCCCGGCTGG + Intergenic
1152099033 17:78290341-78290363 GCAGGCTGGGCGGCAGCGGCAGG + Intergenic
1152321019 17:79608942-79608964 GCCGGCGGGGTGGGGGCGTGGGG - Intergenic
1152570524 17:81119487-81119509 GCAGCCGGGGCGGGTGCGGCCGG + Exonic
1152697494 17:81804309-81804331 GACCGCGGGGCGGGCGCGGCGGG + Intronic
1152703897 17:81833179-81833201 CGGGGCGGGGCGGGCGCGGCTGG - Intronic
1152718579 17:81911507-81911529 GGAGGCGGGGCGGGGGAGGCGGG - Intergenic
1152743854 17:82030399-82030421 GCAGGCGGAGCTGGCGGCTCAGG + Exonic
1152898698 17:82928046-82928068 GCTGGCGGGGCGGGCGGTCCTGG + Intronic
1153006272 18:500801-500823 GAGGGCGGGGCGGGCGCGGGAGG - Intergenic
1153649952 18:7231034-7231056 GCAGGCAGGGAGTGTGCGTCAGG - Intergenic
1153805279 18:8705221-8705243 GGAGGTGGGGCGCGCGCGTGCGG + Intergenic
1153854954 18:9136678-9136700 GCAGGAGGGGCGGGCGCCGGGGG + Intronic
1154214864 18:12408300-12408322 GCAGCCGGAGCGGGGGCGGCCGG + Intronic
1154214873 18:12408315-12408337 GCGGCCGGGGCGGGGGCGGCCGG + Intronic
1157095273 18:44680789-44680811 GCTGGCGGGGCTGGCGGGTTTGG + Intronic
1157353988 18:46917116-46917138 GCGGGCGGCGCGGGGGCGGCGGG - Intronic
1157529648 18:48409908-48409930 GCTGGGGGTGCGGGCGGGTCCGG - Intronic
1157700323 18:49758129-49758151 GCAGGTGGGGCGGGGCCGGCAGG + Intergenic
1158091899 18:53724587-53724609 GCAGGCTGGGTGGGCACCTCTGG + Intergenic
1158729906 18:60011153-60011175 CCAGGCGGGGCAGGCGGGGCAGG + Intergenic
1159040672 18:63320366-63320388 GCGGCCGGGGAGGGCGCGTCCGG + Intergenic
1159435768 18:68414874-68414896 GCAGGCGAGGCGGTCCCCTCAGG - Intergenic
1159947819 18:74457197-74457219 GCAGGAGGCGCGGGCGCTGCGGG - Exonic
1160164123 18:76495342-76495364 CCCCGCGGGGCGGACGCGTCCGG - Intergenic
1160242381 18:77132874-77132896 CCAGGTGGGGCGGGCCCGGCGGG - Intronic
1160726786 19:620962-620984 GCAGGGGGCGCGGGGGCGCCGGG + Intronic
1160788702 19:913058-913080 GCGGGCGGGCGGGGCGCGGCGGG - Intronic
1160835950 19:1124496-1124518 GCAGTGGGGGCGGGCGGGCCTGG + Intronic
1160957175 19:1699146-1699168 CCGGGCGGGGCGGGCGCCGCGGG + Intergenic
1160972632 19:1776221-1776243 CGGGGCGGGGCGGGGGCGTCTGG - Exonic
1161124465 19:2547923-2547945 GCAGCAGGGGCCGGCCCGTCCGG + Intronic
1161312892 19:3604551-3604573 GCAGGCGGGGCGGGCAGGGTGGG - Intronic
1161718785 19:5892106-5892128 GCAGGCGAGGTGGGGGCGCCTGG + Exonic
1161959552 19:7516203-7516225 GCGGCCGGCGCGGGCGCGGCGGG + Exonic
1161973401 19:7596180-7596202 GGCGGCGGGCCGGGCGCGGCAGG + Intronic
1162046854 19:8005662-8005684 GCGCGCGGGGGGGGCGTGTCCGG - Intronic
1162416809 19:10543589-10543611 GGAGGCGGGGCGGGCGCTGCAGG + Intergenic
1162940706 19:14007137-14007159 GCAGGCGGTGCGGCCGCCTTGGG + Intergenic
1163154556 19:15432717-15432739 GCACGCGGGGCGGCCGCCCCAGG + Intronic
1163159900 19:15458206-15458228 GCAGGCGGGGCAGGTGTGTTGGG + Intronic
1163314971 19:16535540-16535562 GCCGGCGGGATGGGCGCGGCGGG + Exonic
1163567135 19:18058521-18058543 GGAGGCAGGGCGGGCCCGGCCGG + Intergenic
1163681280 19:18683927-18683949 GGGGGCGGGGCGCGCGCGGCGGG + Intronic
1164120553 19:22261746-22261768 GCGGGCGGGGCGGGCGGGGCGGG + Intergenic
1164120558 19:22261755-22261777 GCGGGCGGGGCGGGCGGGGCGGG + Intergenic
1164120562 19:22261764-22261786 GCGGGCGGGGCGGGGGTGTCGGG + Intergenic
1164160488 19:22623093-22623115 GCGGGCGGGGCGGGCGGGGCTGG + Intergenic
1164160492 19:22623102-22623124 GCGGGCGGGGCTGGGGTGTCGGG + Intergenic
1166294667 19:41883150-41883172 GGCGGCGGGGCGGGGGCCTCCGG + Intronic
1166316842 19:41994105-41994127 GCGGGCGGGGCGGGGACCTCGGG + Exonic
1166367337 19:42284326-42284348 GCAGGCGGGGCAGGCGGGGCGGG - Intronic
1166367342 19:42284335-42284357 GCGGGCGGGGCAGGCGGGGCAGG - Intronic
1166706053 19:44908641-44908663 GCAGGCGGCGCAGGCCCGGCTGG + Exonic
1167072732 19:47230416-47230438 GCGGGCGGGGCGGGCGCACGTGG - Intronic
1167268281 19:48493971-48493993 GCCGGCGGGGCGGGAGCGCCGGG - Exonic
1168056618 19:53868198-53868220 GCAGGAGGGGCTGGGGGGTCTGG + Intronic
1168241832 19:55092550-55092572 GCAGGGGAGGAGCGCGCGTCAGG + Intronic
1168294171 19:55370551-55370573 GCAGGCAGGGAGGGTGAGTCAGG - Intergenic
1168339714 19:55615935-55615957 GCAGGCGGGGCGGCGGTGGCAGG + Exonic
927714121 2:25341648-25341670 GCAGGCGGGGACGGCGGGCCGGG - Intronic
928093975 2:28392979-28393001 CCGGGCGAGGCGGGCCCGTCCGG + Exonic
929604698 2:43226652-43226674 TGCGGCGGGGCGGGCGCGCCGGG + Intergenic
929830576 2:45343662-45343684 GCAGGCTGTGGGGGCGCGTGCGG + Intergenic
929966853 2:46542875-46542897 GCAGGAGGGGAGGGGGCGGCGGG - Exonic
932699678 2:73984595-73984617 GCAGCCGGGGCCGGCGAGGCGGG - Intergenic
934079018 2:88452165-88452187 GCGGGCGCGGCGGGCGAGGCGGG + Exonic
934079021 2:88452174-88452196 GCGGGCGAGGCGGGCGCGGCGGG + Exonic
934746118 2:96760846-96760868 GCAGGCGGGGCGGGGCGGGCGGG + Intergenic
938320076 2:130356498-130356520 ACAGGTGGGGCGGGCGCCGCAGG + Intronic
940918922 2:159286659-159286681 GCTGGCGGGGCGGGCGCCGGCGG + Intronic
942444423 2:176068547-176068569 GGAGGCGGGGCGAGCCCGGCTGG - Intergenic
946268470 2:218568902-218568924 GGACGCGGGTCGGACGCGTCCGG + Exonic
947566719 2:231198815-231198837 GGCGGCGGAGCGGGCGCGTCGGG - Intronic
947715413 2:232336644-232336666 GCAGGCGGGGCAGGCGGGGCAGG - Exonic
947800827 2:232927846-232927868 GCACGCGGGGGCGGCGCGCCGGG + Intronic
947800934 2:232928208-232928230 GCGGGAGGGGCGCGCGCGGCGGG + Intronic
947800950 2:232928244-232928266 GGCGGCGGGGCGGGGGCGCCCGG + Intronic
948479144 2:238239608-238239630 GCGGGGCGGGCGGGCGGGTCCGG - Intronic
948740644 2:240043737-240043759 CCAGGCGTGGCGGGCAGGTCAGG - Intergenic
949080002 2:242088925-242088947 CCGGGGGCGGCGGGCGCGTCAGG + Intergenic
1168769809 20:408037-408059 GCAGGCGGGGTGGGCGGGGCCGG - Exonic
1168804450 20:664214-664236 GGCGGCGGGGCGGGGGCGGCGGG - Exonic
1169214811 20:3786715-3786737 GCGGGCGGCGCGGGCGCGGAAGG + Intergenic
1171361614 20:24590263-24590285 GCAGGTGGGGCCGGCGCGGCGGG + Intronic
1172099747 20:32478015-32478037 GCAGGCGGGGCGGGCCTCGCAGG - Intronic
1172474563 20:35226981-35227003 GCAGGTGGGGCTGGCGCGCGGGG + Exonic
1172848418 20:37944170-37944192 GGCGGCGGGGCGGGCGCGGCGGG - Exonic
1173384608 20:42575866-42575888 GCAGGCGGGGAGGGAGCTGCTGG - Intronic
1173582967 20:44160236-44160258 GCCGGCGAGGCGGGAGAGTCCGG + Exonic
1174182965 20:48686643-48686665 GCAGGCGGGGCGGGGCAGCCTGG - Intronic
1174287262 20:49482488-49482510 GCAGGGGGGGCGGGGGCGGCCGG - Exonic
1174298874 20:49568123-49568145 GCTGGCGGGGCTGGCGGGGCTGG + Exonic
1174298878 20:49568132-49568154 GCTGGCGGGGCTGGCGGGGCTGG + Exonic
1175424407 20:58854676-58854698 GCAGGGGCGGCGGGAGCCTCAGG - Exonic
1175521288 20:59604175-59604197 GGTGCCGGGGTGGGCGCGTCGGG + Intronic
1175521522 20:59605145-59605167 GCGGGGGCGGCGGGCGGGTCGGG + Intronic
1175954817 20:62603862-62603884 GCAGGCGGGGGGGACGCGGGGGG - Intergenic
1176039463 20:63056612-63056634 GCTGGCGGGGCTGGCGGGGCTGG + Intergenic
1176039467 20:63056621-63056643 GCTGGCGGGGCTGGCGGGGCTGG + Intergenic
1176039471 20:63056630-63056652 GCTGGCGGGGCTGGCGGGGCTGG + Intergenic
1176178112 20:63738068-63738090 GAGGGCGGGGCGGGGGCGGCCGG + Intronic
1176194469 20:63830976-63830998 GCCGGCGGCGGGGGCGCGCCCGG + Intronic
1176194574 20:63831302-63831324 GCGGGCGGGGCGCGCGCGCGCGG - Intergenic
1176229731 20:64026069-64026091 GCAGGCAGGGCTGGGCCGTCTGG + Intronic
1176234829 20:64049362-64049384 GGCGGCGAGGCGGGCGCGGCGGG + Exonic
1176237970 20:64063098-64063120 GCGGGCGCGGCGGGCGCGGCAGG + Intronic
1176550503 21:8218973-8218995 CCCGGCGGGGCGTGCGCGTCCGG + Intergenic
1176569433 21:8402012-8402034 CCCGGCGGGGCGTGCGCGTCCGG + Intergenic
1176577345 21:8446243-8446265 CCCGGCGGGGCGTGCGCGTCCGG + Intergenic
1179935557 21:44601676-44601698 GCAGGCCGGGCGGGAGCATGCGG - Exonic
1180045010 21:45301295-45301317 GCAGGCGGGGGCGGCGCTCCGGG - Intergenic
1180223098 21:46371738-46371760 GCAGGCGGGGTGGTGGCGCCTGG - Intronic
1180791537 22:18577854-18577876 GCGGACGGGGCGGGCGCGTGCGG - Intergenic
1181147535 22:20859204-20859226 GCGGGCGCGTCGGGCCCGTCGGG - Exonic
1181230203 22:21417457-21417479 GCGGACGGGGCGGGCGCGTGCGG + Intronic
1181248446 22:21517406-21517428 GCGGACGGGGCGGGCGCGTGCGG - Intergenic
1182532233 22:30969356-30969378 GGAGGGGGGGAGGGCGCGCCAGG - Intergenic
1182776085 22:32831954-32831976 GCAGGCAGGGCAGGCGTGGCAGG + Intronic
1183545914 22:38454884-38454906 GCGGGCGGGGCCGGAGCGGCGGG + Intronic
1183601706 22:38843894-38843916 GCAGGCGCGGCGGCGGGGTCGGG + Exonic
1184152988 22:42649272-42649294 GTAGGCGGGGAGGGGGCGCCGGG - Intronic
1184276553 22:43412167-43412189 GGAGGCGGGCGGGGCGCGGCGGG + Intronic
1184342218 22:43892153-43892175 GGATCCGGGGCGGGCGCGTGGGG - Intergenic
1184474832 22:44714753-44714775 ACAGGCGTGGCTGGCGGGTCAGG - Intronic
1184759407 22:46536474-46536496 CCGGGCGGGGCCGGCGCGACGGG - Exonic
1184785323 22:46668757-46668779 TCAGGCCGGGCGGGCGCCGCAGG - Intronic
1185246916 22:49777617-49777639 CCAGGCGGGGCGGGCGGTGCTGG + Intronic
1203255400 22_KI270733v1_random:135314-135336 CCCGGCGGGGCGTGCGCGTCCGG + Intergenic
950225971 3:11234758-11234780 TCAGGCAGGGCGGGCACCTCTGG + Intronic
950518131 3:13480425-13480447 GACGGCCGGGCGGGCGCGCCAGG + Intronic
950902920 3:16513416-16513438 GGCGGCGGGGGGGGCGCGACAGG - Intronic
950902995 3:16513700-16513722 GGCGGCGGCGGGGGCGCGTCGGG - Exonic
953246516 3:41199136-41199158 ACGCGCGGGGCGGGGGCGTCGGG + Intronic
953406980 3:42664511-42664533 GCAGGTGGGGCGGGGGCGGCAGG - Exonic
956628031 3:71286305-71286327 GCGGGCGGGGCGGGGGTGGCGGG - Intronic
958026816 3:88058974-88058996 GCAGGCGGACGGGGCGCGGCGGG - Intronic
959849636 3:111071659-111071681 GCGGGGAGGGCGGGCGAGTCGGG + Intronic
963061610 3:141231358-141231380 GCCGGGTGGGCGCGCGCGTCTGG - Intronic
966919276 3:184601783-184601805 CGAGGCGGGGCGGGTGGGTCGGG - Intronic
968010438 3:195270850-195270872 GCGGGCGGCGAGGGCGCGGCGGG + Exonic
968135401 3:196216644-196216666 GCAGGCGGGGCGGGCAGGTGGGG - Exonic
968471823 4:786087-786109 GCGGGCGGGGCGAGGGCGGCGGG - Exonic
968652939 4:1767266-1767288 GCAGACGGGCCGGGCCCCTCTGG - Intergenic
968733337 4:2282174-2282196 GCAGCCGGTGCGGGAGTGTCTGG - Intronic
968775183 4:2536157-2536179 GCGGGCGAGGCGGGCGGGGCGGG + Intronic
969344728 4:6563625-6563647 GCGGGCGCGGCGGGCGCGGCGGG + Intergenic
969715855 4:8867796-8867818 GGGGGCGGCGCGGGCGCGGCGGG + Exonic
970202857 4:13627454-13627476 GCGGGCGGGGCGGGCGGCGCGGG - Exonic
975779012 4:77819756-77819778 GGATGCGGGGCGGGCGGGCCGGG + Intergenic
977536568 4:98261391-98261413 GCAGGCGGCGCGGCCGCGGCGGG - Intronic
981067211 4:140498044-140498066 GCAGGCGGGGCAGGGTCGGCGGG - Intronic
981491586 4:145346210-145346232 GCTGGCGGGGCTGGCGGGGCTGG + Intergenic
981550574 4:145937665-145937687 GCGGGCGAGGCGGGAGCGGCTGG - Intronic
984146365 4:176065968-176065990 GCAGGCGGGGAGGGCGGGGAGGG + Exonic
984811356 4:183798269-183798291 GCAGGCGGGGGCGGCGCACCGGG - Intergenic
984953224 4:185021318-185021340 GCGTGCGGTGCGCGCGCGTCGGG - Intergenic
985068408 4:186144885-186144907 TCAGGCGGCCCGGGCGCGCCCGG - Exonic
985549185 5:524557-524579 GCGGGCGGGGCGGGCGTGCCGGG - Intergenic
985550104 5:528560-528582 GCGGGCGGGGCGGGAGGGACAGG - Intergenic
985550107 5:528569-528591 GCGGGCGGGGCGGGCGGGGCGGG - Intergenic
985640415 5:1061055-1061077 GCAGGTGCGGCGGGTGCGGCGGG - Intronic
985640538 5:1061505-1061527 GCAGGTGCGGCGGGTGCGGCGGG - Intronic
985660859 5:1155918-1155940 GCCGGCGGGGCGGGCGCGGGAGG + Intergenic
985696662 5:1344854-1344876 GCGGGCGGGCCGGGGGCGCCGGG - Exonic
985995645 5:3595715-3595737 GCGGGAGGGGCGGGAGCGGCCGG + Intergenic
988031453 5:25769095-25769117 GCAAGCGGGGCCGGCTTGTCGGG - Intergenic
989643237 5:43603323-43603345 GCAGCCGGGGCGCGCGCCTAGGG + Intronic
992939512 5:81750032-81750054 GCGGGAGGGGCGGGCCCGGCGGG - Intronic
997647641 5:135491642-135491664 GCAGGCCGGGCGGGCGCGTGGGG + Intergenic
998374567 5:141682231-141682253 GGAGGCGGGGCCGGCGCGGCGGG - Intergenic
999129450 5:149271807-149271829 GCGGGCGGGGCGGGGGCTGCCGG + Intergenic
999305974 5:150519892-150519914 GCAGGCGGTGCGGGGGGTTCAGG + Intronic
999782196 5:154858522-154858544 GCAGGCGAGTCGGGCGGATCGGG + Exonic
1000071355 5:157743795-157743817 GCGGGCTGGGCGGGCGCGCGGGG - Exonic
1000071432 5:157744048-157744070 GGGTCCGGGGCGGGCGCGTCCGG - Exonic
1002401721 5:178994857-178994879 GCAGGCGGGCCTGGCGCGCGCGG - Exonic
1002895653 6:1378696-1378718 GCCGGCGGGGGTGGCGCGGCCGG + Intergenic
1005856103 6:29864214-29864236 GGAGGCGGAGAGAGCGCGTCAGG + Intergenic
1006336982 6:33425969-33425991 GCTGGCGGGGCGGGGGCGTCGGG + Intronic
1006725380 6:36196456-36196478 GGTGGCGGTGCGGGCGCGGCGGG - Intergenic
1006860696 6:37170101-37170123 GCGCGCGGGGAGGGCGCGGCGGG - Intergenic
1006860702 6:37170114-37170136 GCCGGCGGGGAGGGCGCGCGGGG - Intergenic
1007390240 6:41546504-41546526 GCAGGCGGCGGCGGCGCGGCGGG + Exonic
1007785248 6:44276078-44276100 GTAGGCGGCCCGGGCGCGGCGGG + Exonic
1008956560 6:57222106-57222128 GCAGGGAGAGCTGGCGCGTCGGG - Exonic
1009379652 6:63011248-63011270 GCAGGCGGGGAGGGGGGGTAGGG - Intergenic
1009864042 6:69374401-69374423 GCAGGCGGAGCAGGAGTGTCAGG - Intronic
1010379072 6:75205957-75205979 GGAGGAGAGGCGGGCGCGGCAGG + Exonic
1011633918 6:89352887-89352909 GCAAGCCGGGCGGCCGCGGCAGG - Intergenic
1012916903 6:105180064-105180086 GCGGGCGCGGCGGCTGCGTCTGG + Intergenic
1012939668 6:105403214-105403236 CCGGGCGGCGCGGGCGCGGCCGG - Intergenic
1016386756 6:143537069-143537091 GCCGGCGGGGCGGGCGCCTCGGG - Intronic
1017163726 6:151390105-151390127 GCAGGCGCAGATGGCGCGTCGGG + Intronic
1017920730 6:158869855-158869877 GGGGGCGGGGCCGGCGCGACCGG + Intergenic
1018252199 6:161882335-161882357 GGGGGCGGGGCGGGGGCGTGCGG + Intronic
1018400188 6:163414236-163414258 GCGGTCGGGGCTGGCGCGGCAGG - Intronic
1018613211 6:165662675-165662697 GCCGGCGGGGGGAGCGCGGCGGG - Intronic
1018613283 6:165662843-165662865 GCGGGCGGGAGGGGCGCGGCGGG + Intronic
1018899850 6:168045555-168045577 CCAGGCAGGGAGGGGGCGTCTGG + Intergenic
1019530138 7:1499200-1499222 GCGGCGGGGGCGGGCGCCTCGGG - Intronic
1020278232 7:6637291-6637313 GCGGGCGGGGCGGGGCCGGCCGG + Intergenic
1020552286 7:9621703-9621725 GCCGGCGGGGCCGGCGGGGCGGG + Intergenic
1021983669 7:26079116-26079138 GCGGGCGGTGTGGGCGCGTCGGG - Intergenic
1022100139 7:27164625-27164647 GGGGGCGGGGCGGGCACTTCGGG - Intronic
1023861572 7:44220304-44220326 GCAGGCGGGGCGGGGGTCTCGGG + Intronic
1024043786 7:45574346-45574368 GCAGGCGCGGCGGGCGGGAGGGG + Intronic
1024043865 7:45574577-45574599 GGAGGCGGCGCGGGCGAGCCCGG + Exonic
1026004779 7:66592070-66592092 GCAGGCGGGGCTGACGAGGCTGG + Intergenic
1026941243 7:74289341-74289363 GCGGGAGGGGGGGGCGGGTCAGG - Intergenic
1027539939 7:79453861-79453883 GGAGGAGGGGCGCGCGCGCCGGG + Intergenic
1029123214 7:98281767-98281789 GCCGGAGCGGCGGGCGCGGCCGG + Exonic
1032122857 7:129169304-129169326 GCAGGCGGGGCGGGCGCGTCCGG + Intronic
1032283387 7:130523910-130523932 TCAGGCAGGGCGGGAGAGTCAGG + Intronic
1032284129 7:130528135-130528157 TCAGGCAGGGCGGGAGAGTCAGG + Intronic
1033299840 7:140176417-140176439 GCGGGCGCGGCGGGGGCGTCGGG - Intronic
1034414720 7:150958400-150958422 GCGGGCGGCGCGGGCGCCCCGGG - Exonic
1034441059 7:151086354-151086376 GCAGGAGGGGCGGGGGCGGCGGG + Intronic
1034618074 7:152436032-152436054 GCGGGCGGGGCGGGCGGTGCGGG + Intergenic
1034618084 7:152436055-152436077 GCGGGCGGGGCCGGCGGGTGCGG + Intergenic
1035266824 7:157693719-157693741 GCGGGCGGGGAGGGTGCGCCAGG - Intronic
1035538040 8:407190-407212 CCGGGGGCGGCGGGCGCGTCAGG + Intronic
1036814138 8:11888580-11888602 GCAGGAGGGCCGGGCGTGTAGGG + Intergenic
1037473865 8:19237533-19237555 GCAGCCGGGCCGTGCACGTCTGG + Intergenic
1045432152 8:102124160-102124182 GCAGCCGGGGCGGGTGTGCCGGG - Intronic
1049367934 8:142249658-142249680 GCAGGCAGGCCGTCCGCGTCAGG + Intronic
1049387351 8:142349993-142350015 GCAGGCAGGGCGGGCAAGGCTGG + Intronic
1049387363 8:142350023-142350045 GCAGGCAGGGCGGGCAGGGCTGG + Intronic
1049387402 8:142350131-142350153 GCAGGCAGGGCGGGCAGGGCTGG + Intronic
1049387432 8:142350212-142350234 GCAGGCAGGGCGGGCAGGGCTGG + Intronic
1049396434 8:142403144-142403166 GCGGGCGAGGCGGGCGGGGCGGG + Exonic
1049673122 8:143878419-143878441 GCAGGTGCGGCGGGTGCGGCGGG - Exonic
1051174017 9:14346123-14346145 GCGGGCGCGGGGGGCGCGTGGGG + Intronic
1056163551 9:83921275-83921297 GCGGGAGCGGCGGGCGCGGCGGG + Intronic
1058022033 9:100099343-100099365 GCAGGAGGGGCGGCCCGGTCCGG + Exonic
1059176765 9:112175252-112175274 GGAGGAGGCGCGGGCGCGCCGGG - Exonic
1059414864 9:114156211-114156233 GCAGCCGGGCCAGGCGCGGCAGG - Intronic
1060410327 9:123395806-123395828 GGAGGCGGGGTAGGGGCGTCCGG - Intronic
1060849224 9:126860781-126860803 GCGGGCGGGGCAGGCGGGGCAGG + Intronic
1060849229 9:126860790-126860812 GCAGGCGGGGCAGGCGGGGCGGG + Intronic
1061120065 9:128636672-128636694 GCTGGTGGGGCGGGCGAGGCAGG + Intronic
1061196037 9:129107834-129107856 GCAGAAGGGGCTGGAGCGTCGGG - Exonic
1061215998 9:129222400-129222422 GCAGGTGGGGCTGGCGGCTCAGG - Intergenic
1061367829 9:130181746-130181768 GCAGGCAGGGCGGGTGCTGCGGG + Intronic
1061449471 9:130660617-130660639 GCCGGCGGGGCGGGCAGGGCGGG + Intergenic
1061584042 9:131554964-131554986 GCGGGCGGCGTGGGCGCGGCTGG - Intergenic
1061610026 9:131739984-131740006 GCGGGCGCGGCGGGAGCGGCTGG - Intronic
1062230676 9:135479981-135480003 GCAGGCGGGGTCCGCGCGGCGGG + Exonic
1062383179 9:136297541-136297563 GCAGGCCCGGCTGGAGCGTCAGG - Intronic
1062412730 9:136433123-136433145 GCTGGAGGGGTGGGCGCGGCTGG - Intronic
1203471798 Un_GL000220v1:118449-118471 CCCGGCGGGGCGTGCGCGTCCGG + Intergenic
1186466213 X:9786305-9786327 GGGGGCGGGGCGGGCGCGTTCGG - Intergenic
1189337050 X:40176425-40176447 GCAGGCGGGGATGGCGGTTCCGG + Intronic
1190297894 X:49039238-49039260 GCAGGAGAGGCGTGAGCGTCGGG - Exonic
1192237551 X:69305706-69305728 GCAGGCGGCGAGGCCGCGCCGGG - Intergenic
1192624604 X:72714301-72714323 GGAGGCGGGGCGGGCGCGACTGG + Intronic
1197754305 X:129983708-129983730 GCCGCCGGGCCGGGCGCGGCGGG + Intronic
1198398840 X:136250958-136250980 ACGGGCGGGGCGGGGGCGGCTGG - Intronic
1198480219 X:137033916-137033938 GCGGGCGCTGCGGGCGCGGCAGG + Intergenic
1200126797 X:153819055-153819077 GGGGGCGGGGCGAGCGCGCCTGG - Intronic
1200233619 X:154458211-154458233 CCGCGCGGGGCGGGGGCGTCCGG - Intergenic