ID: 1032123851

View in Genome Browser
Species Human (GRCh38)
Location 7:129176435-129176457
Sequence CTAAGTTTACATTCTACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032123841_1032123851 28 Left 1032123841 7:129176384-129176406 CCAGGTGCCATTCTAGCACCAGG No data
Right 1032123851 7:129176435-129176457 CTAAGTTTACATTCTACTGGAGG No data
1032123844_1032123851 21 Left 1032123844 7:129176391-129176413 CCATTCTAGCACCAGGGAGAGAA No data
Right 1032123851 7:129176435-129176457 CTAAGTTTACATTCTACTGGAGG No data
1032123845_1032123851 10 Left 1032123845 7:129176402-129176424 CCAGGGAGAGAACATAACAAATG No data
Right 1032123851 7:129176435-129176457 CTAAGTTTACATTCTACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032123851 Original CRISPR CTAAGTTTACATTCTACTGG AGG Intergenic
No off target data available for this crispr