ID: 1032128504

View in Genome Browser
Species Human (GRCh38)
Location 7:129211433-129211455
Sequence GCCTCCAGTTAGGCCCTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032128500_1032128504 -5 Left 1032128500 7:129211415-129211437 CCAAGAACTGGATTTCTGGCCTC 0: 1
1: 0
2: 1
3: 26
4: 222
Right 1032128504 7:129211433-129211455 GCCTCCAGTTAGGCCCTTTGGGG 0: 1
1: 0
2: 0
3: 7
4: 107
1032128497_1032128504 19 Left 1032128497 7:129211391-129211413 CCTGGGCAAGAGTAAGTCAGGGT 0: 1
1: 0
2: 0
3: 14
4: 193
Right 1032128504 7:129211433-129211455 GCCTCCAGTTAGGCCCTTTGGGG 0: 1
1: 0
2: 0
3: 7
4: 107
1032128495_1032128504 20 Left 1032128495 7:129211390-129211412 CCCTGGGCAAGAGTAAGTCAGGG 0: 1
1: 0
2: 0
3: 14
4: 168
Right 1032128504 7:129211433-129211455 GCCTCCAGTTAGGCCCTTTGGGG 0: 1
1: 0
2: 0
3: 7
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032128504 Original CRISPR GCCTCCAGTTAGGCCCTTTG GGG Intronic
900740169 1:4326367-4326389 GCTTGCTGTTAGGCCATTTGAGG - Intergenic
901235982 1:7667873-7667895 CCACCCAGCTAGGCCCTTTGGGG + Intronic
901772494 1:11537371-11537393 GCCCCCAGAGAGGGCCTTTGAGG - Exonic
904402458 1:30265847-30265869 GCCTCCTGTGAGTCCCTGTGGGG - Intergenic
912436794 1:109667970-109667992 GCCTCCAGATTGGCCCGTTTCGG + Intronic
912469475 1:109896490-109896512 GCCTCTAGTTATGCCCTTCTGGG - Intergenic
920404163 1:205696687-205696709 GGCTCCAGTTAGGACCTGAGAGG + Intergenic
921263979 1:213407067-213407089 GCCTCCGGGTAGGACCTTGGGGG - Intergenic
921899426 1:220434950-220434972 GCCCCTGGTTTGGCCCTTTGTGG - Intergenic
1065094091 10:22263663-22263685 GCCTCCAGGTAGGTCCTGAGCGG - Intergenic
1072688508 10:97553805-97553827 CCCTCCAGGTAGGGCCTCTGTGG - Intronic
1074043963 10:109819863-109819885 TGCTCCAGCCAGGCCCTTTGGGG + Intergenic
1074091952 10:110268733-110268755 CTCTTCAGTTGGGCCCTTTGTGG + Intronic
1074983745 10:118639912-118639934 GCCTCCACCTTTGCCCTTTGGGG - Intergenic
1076003203 10:126928552-126928574 GGCTCCACTGAGGCCCTTGGGGG - Intronic
1076141368 10:128081001-128081023 GCCTCCAGTTAGGACGGTTGAGG + Intronic
1080715127 11:34792655-34792677 GTCTCCATATAGGCCTTTTGGGG + Intergenic
1081394523 11:42569808-42569830 GACTCCAGGTAGCTCCTTTGTGG - Intergenic
1084567522 11:69939923-69939945 TCCTCCAGCCAGGCCCTCTGGGG + Intergenic
1084825182 11:71724433-71724455 GCCTCCAGTTAGGCAACTCGGGG - Intergenic
1088822876 11:113471451-113471473 ACCTCCAGTAAGGCATTTTGTGG - Intronic
1092165897 12:6341988-6342010 GGCTCCAGTTCTGGCCTTTGGGG - Exonic
1092868397 12:12784384-12784406 GCCTCCAGTGTGTCCTTTTGAGG - Intronic
1092917267 12:13200251-13200273 GCTTCTAGCTAGGCCTTTTGGGG + Intronic
1093362340 12:18246154-18246176 GCCTTCAGTTTTGCCCATTGTGG - Intronic
1096626445 12:52898883-52898905 GCCTCCAGGGAAGCCCTCTGTGG + Exonic
1097177247 12:57150566-57150588 CCCTCCAGGTGGGCCATTTGGGG - Intronic
1100536490 12:95515434-95515456 CCCTCCAGCTAGCTCCTTTGGGG + Exonic
1100626834 12:96343492-96343514 GCCTTTATTTAGGCCCTCTGGGG + Intronic
1102015314 12:109644443-109644465 GGCTCCTGTTAGGCCCCCTGAGG + Intergenic
1105637448 13:22229031-22229053 GCCTGCAGTGTGGCCTTTTGAGG + Intergenic
1105948743 13:25211387-25211409 ACCAGCAGTGAGGCCCTTTGTGG + Intergenic
1112207257 13:97337073-97337095 GCCTCCCCATAGGCCCTTAGAGG - Intronic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1113462896 13:110493996-110494018 GCTTCCACTTAGGAACTTTGGGG + Intronic
1113522983 13:110953793-110953815 GCCCCCAGTGAGGCCCTCTGTGG + Intergenic
1116036976 14:39638950-39638972 CCTCCCAGTTAGGCTCTTTGGGG + Intergenic
1117376584 14:55123369-55123391 GCCTCCAGTGAGGCCCCATTTGG + Intergenic
1117530674 14:56657787-56657809 GGGTCCAGTGAAGCCCTTTGTGG - Intronic
1121486625 14:94321410-94321432 GCCTCAAATCTGGCCCTTTGGGG + Intronic
1122745865 14:103896899-103896921 GCTACCAGTTAGCCACTTTGGGG - Intergenic
1128217810 15:65946377-65946399 GCCTCCAGTGAAGACATTTGGGG + Intronic
1133911724 16:10072165-10072187 GTCTCAAGTGATGCCCTTTGTGG + Intronic
1135062959 16:19286441-19286463 GCCTCCAGGGAGGCCATTAGAGG - Intronic
1136451643 16:30357221-30357243 CCCTCCAGTTAGTCCCTATCTGG - Exonic
1137708332 16:50549732-50549754 GCCTCCAGCTGGGCACTTCGAGG - Intronic
1141849310 16:86633770-86633792 GACTACAGTTAGGGGCTTTGAGG + Intergenic
1143373469 17:6454448-6454470 TCCTGCAGTTTGGCCCATTGAGG - Exonic
1145921202 17:28611459-28611481 TCCTCCACTTAGGACCTCTGGGG + Exonic
1148022189 17:44560597-44560619 GTCTCTGGATAGGCCCTTTGTGG + Intergenic
1149555175 17:57568507-57568529 TCCTGCTGTGAGGCCCTTTGGGG - Intronic
1150138265 17:62707587-62707609 ACCTCCAGCTAGGCTCTTCGCGG - Intronic
1150351047 17:64444719-64444741 GGCTCCAGGTAGGTCTTTTGAGG + Intergenic
1150883066 17:69053068-69053090 TCCTTCAGTTAGGGCTTTTGTGG + Intronic
1155335753 18:24763882-24763904 ACTTCCAGTGAGGCCCTCTGGGG - Intergenic
1156966851 18:43105026-43105048 CCCTCTAATCAGGCCCTTTGTGG + Intronic
1157136425 18:45061320-45061342 GCACCCTGCTAGGCCCTTTGAGG + Intronic
1157897186 18:51480355-51480377 TCCTCCAGTTAGGTATTTTGGGG - Intergenic
1159908783 18:74123476-74123498 GCCTCCACATAGCCCCTTTTTGG - Exonic
1160265905 18:77340750-77340772 GCCACAAGCTAGTCCCTTTGGGG + Intergenic
1161802994 19:6426108-6426130 GACTCCAGTCTGGCCCCTTGTGG - Exonic
1163677390 19:18662182-18662204 GCCTCCTGTAAAGCCCTTGGAGG - Intronic
1167174842 19:47858736-47858758 GCCTCCTCTTTGGTCCTTTGAGG - Intergenic
925889815 2:8424471-8424493 GGCTCCAGTTTGGCCCCATGTGG + Intergenic
927182561 2:20457255-20457277 GCCTCCAGTTACCCCCTTCATGG - Intergenic
929386061 2:41408737-41408759 ACTTGCAGTTAGGCCATTTGAGG - Intergenic
931264368 2:60647349-60647371 GTCTCCAGATGGGCCCTTTTTGG + Intergenic
932197853 2:69799635-69799657 CCCTCCAGTTAGCTCCTTGGGGG + Intronic
935211633 2:100943817-100943839 ACCTGCAGTTAGGCCATTTGAGG + Intronic
935813751 2:106826899-106826921 ACCTCCAGTGCAGCCCTTTGTGG + Intronic
942454062 2:176125538-176125560 GCCCCCAGCTTGGCCCTCTGAGG + Intergenic
943576617 2:189638072-189638094 GCCTACAGGTAGTACCTTTGTGG - Intergenic
1170829274 20:19825497-19825519 CCCTTCAGCTAGGCCTTTTGTGG + Intergenic
1177455502 21:21332335-21332357 GCTTCCATTTAGGCTCTTTTAGG + Intronic
1179022818 21:37655768-37655790 GCCTCTAGTTATGACCTTTGGGG - Intronic
1184594801 22:45507201-45507223 GCCTCTAGTTAGGACCACTGTGG - Intronic
951425929 3:22544946-22544968 GCCCCTGGTTTGGCCCTTTGTGG + Intergenic
953371260 3:42390471-42390493 GTGTCCAGTTAGTCCCTCTGGGG - Intergenic
958167828 3:89900113-89900135 GCCTCCAGTTAGGCTACTTTGGG - Intergenic
965360510 3:167734350-167734372 GACTCGGGTTATGCCCTTTGAGG - Exonic
967772775 3:193353212-193353234 GCCTCCAGTTGGCCCCTATGTGG - Intronic
968514009 4:1008883-1008905 GCCTCCAGGCAGACCCTCTGTGG + Intergenic
968729797 4:2264353-2264375 GCCTCAATTTAGGCCATTTAAGG + Intergenic
970514836 4:16818124-16818146 CCTTCCAGTTATCCCCTTTGAGG - Intronic
994179332 5:96746572-96746594 CCCTACAGTTAGACCCCTTGAGG + Intronic
995492219 5:112705509-112705531 GTTTCCAGGCAGGCCCTTTGAGG + Intergenic
996805183 5:127446701-127446723 GCTTCCAATCAGGCCCTTTTAGG + Intronic
998138370 5:139686246-139686268 GCCTCCAGGTAGCCCCTGCGTGG + Intergenic
998421124 5:141987419-141987441 GCCTCCATCTAGGCCCTCAGTGG + Intronic
999486697 5:152004241-152004263 GCCTCCAGTTGGGGCCTGAGCGG + Intergenic
1001037934 5:168311260-168311282 GCTTCAAGTCAGGCCCTTTCTGG + Intronic
1006380673 6:33695353-33695375 GCTGCCAGGTAGGTCCTTTGAGG + Intronic
1006925074 6:37649498-37649520 GCCTCCAGTCACGCCCTAAGTGG + Intronic
1009191799 6:60638367-60638389 ACCTACAGTTAGGCCATTCGAGG - Intergenic
1016386996 6:143538126-143538148 GCCTCAAGCTAGCCCCTCTGCGG + Intronic
1016586904 6:145698413-145698435 GCCTCCAGTGGGGATCTTTGAGG + Intronic
1016919962 6:149283086-149283108 TCCTCCAGTTAGTACGTTTGAGG + Intronic
1017411255 6:154169818-154169840 GCCTCTGGTCAGGCCATTTGGGG + Intronic
1019393768 7:805414-805436 GCCTCCACTGAGGACCTTTCTGG + Intergenic
1023294317 7:38699217-38699239 GGCTCCAATGAGGCCATTTGGGG + Intergenic
1023909073 7:44541149-44541171 GCCTCCAGTTAGGGACCCTGGGG - Intronic
1029979514 7:104864812-104864834 GCCCCCAGTTAGGCTACTTGGGG - Intronic
1032128504 7:129211433-129211455 GCCTCCAGTTAGGCCCTTTGGGG + Intronic
1036215771 8:6878510-6878532 GCCCCCAGTGTGGCCCTTGGAGG + Intergenic
1036370317 8:8156654-8156676 GCCTCCAGTTAGGCAACTCGGGG - Intergenic
1036880575 8:12508977-12508999 GCCTCCAGTTAGGCAACTCGGGG + Intergenic
1039567186 8:38559991-38560013 GCCTCTAGTTTGGCTCTTTCTGG + Intergenic
1040708869 8:50163123-50163145 CCCTCCAGGGAGGCCCTTTCTGG + Intronic
1042722461 8:71841329-71841351 GCCTCCAGTTATGGCCTTCCAGG + Intronic
1045367916 8:101493536-101493558 GCCTCGAGTTAGGGCCTCGGCGG + Intronic
1046806350 8:118482859-118482881 GCTTCCAGGTAGGTCCTTTCTGG - Intronic
1059557187 9:115293103-115293125 TCCTCTAGATAGGCCCTTTGGGG - Intronic
1060988796 9:127836494-127836516 GCCTCCAGTCAGGCCCTGGGAGG - Intronic
1188424252 X:30028399-30028421 GACTTCAGTTACGCCCTCTGTGG - Intergenic
1190825922 X:54017863-54017885 GCCTCCAATAAGGCCTTTAGTGG - Intronic