ID: 1032131814

View in Genome Browser
Species Human (GRCh38)
Location 7:129235403-129235425
Sequence AAGAAGAATGAGAAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2457
Summary {0: 1, 1: 0, 2: 28, 3: 305, 4: 2123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032131814_1032131819 20 Left 1032131814 7:129235403-129235425 CCAGCCTCCTTCTCATTCTTCTT 0: 1
1: 0
2: 28
3: 305
4: 2123
Right 1032131819 7:129235446-129235468 AGGGTCTCACTGTGTCACCCAGG 0: 375
1: 9015
2: 32100
3: 85607
4: 170274
1032131814_1032131818 1 Left 1032131814 7:129235403-129235425 CCAGCCTCCTTCTCATTCTTCTT 0: 1
1: 0
2: 28
3: 305
4: 2123
Right 1032131818 7:129235427-129235449 TTCTTCTTTCTCTTGAGACAGGG 0: 1
1: 6
2: 171
3: 1874
4: 20047
1032131814_1032131820 24 Left 1032131814 7:129235403-129235425 CCAGCCTCCTTCTCATTCTTCTT 0: 1
1: 0
2: 28
3: 305
4: 2123
Right 1032131820 7:129235450-129235472 TCTCACTGTGTCACCCAGGCTGG 0: 1468
1: 36819
2: 91431
3: 177348
4: 206241
1032131814_1032131817 0 Left 1032131814 7:129235403-129235425 CCAGCCTCCTTCTCATTCTTCTT 0: 1
1: 0
2: 28
3: 305
4: 2123
Right 1032131817 7:129235426-129235448 CTTCTTCTTTCTCTTGAGACAGG 0: 1
1: 3
2: 49
3: 484
4: 3821

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032131814 Original CRISPR AAGAAGAATGAGAAGGAGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr