ID: 1032131819

View in Genome Browser
Species Human (GRCh38)
Location 7:129235446-129235468
Sequence AGGGTCTCACTGTGTCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297371
Summary {0: 375, 1: 9015, 2: 32100, 3: 85607, 4: 170274}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032131814_1032131819 20 Left 1032131814 7:129235403-129235425 CCAGCCTCCTTCTCATTCTTCTT 0: 1
1: 0
2: 28
3: 305
4: 2123
Right 1032131819 7:129235446-129235468 AGGGTCTCACTGTGTCACCCAGG 0: 375
1: 9015
2: 32100
3: 85607
4: 170274
1032131813_1032131819 26 Left 1032131813 7:129235397-129235419 CCTCATCCAGCCTCCTTCTCATT 0: 1
1: 0
2: 8
3: 114
4: 879
Right 1032131819 7:129235446-129235468 AGGGTCTCACTGTGTCACCCAGG 0: 375
1: 9015
2: 32100
3: 85607
4: 170274
1032131815_1032131819 16 Left 1032131815 7:129235407-129235429 CCTCCTTCTCATTCTTCTTCTTC 0: 5
1: 54
2: 649
3: 2513
4: 6435
Right 1032131819 7:129235446-129235468 AGGGTCTCACTGTGTCACCCAGG 0: 375
1: 9015
2: 32100
3: 85607
4: 170274
1032131812_1032131819 29 Left 1032131812 7:129235394-129235416 CCACCTCATCCAGCCTCCTTCTC 0: 1
1: 0
2: 19
3: 208
4: 1873
Right 1032131819 7:129235446-129235468 AGGGTCTCACTGTGTCACCCAGG 0: 375
1: 9015
2: 32100
3: 85607
4: 170274
1032131816_1032131819 13 Left 1032131816 7:129235410-129235432 CCTTCTCATTCTTCTTCTTCTTC 0: 2
1: 168
2: 1042
3: 2992
4: 6729
Right 1032131819 7:129235446-129235468 AGGGTCTCACTGTGTCACCCAGG 0: 375
1: 9015
2: 32100
3: 85607
4: 170274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032131819 Original CRISPR AGGGTCTCACTGTGTCACCC AGG Intronic
Too many off-targets to display for this crispr