ID: 1032140069

View in Genome Browser
Species Human (GRCh38)
Location 7:129320769-129320791
Sequence GAGGAAAATACCACCACTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032140069_1032140070 -9 Left 1032140069 7:129320769-129320791 CCATTAGTGGTGGTATTTTCCTC 0: 1
1: 0
2: 0
3: 16
4: 158
Right 1032140070 7:129320783-129320805 ATTTTCCTCCCCCCAGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032140069 Original CRISPR GAGGAAAATACCACCACTAA TGG (reversed) Intronic
901466862 1:9427363-9427385 GCAGAGAACACCACCACTAATGG - Intergenic
903505212 1:23829210-23829232 GAGGAACATAGCAACACTATTGG - Intronic
904217415 1:28933319-28933341 AAGGAAAATACCACCAGCTAAGG - Intronic
905142173 1:35856141-35856163 TAGGAAAATAGTACCATTAAAGG + Exonic
905383427 1:37581206-37581228 GAGGAAAATAACAGAACTAATGG + Intronic
906472532 1:46143141-46143163 GAGAAAAATACTACCAATGAAGG - Intronic
906907620 1:49912809-49912831 GAGGATAATTCCACAACAAAAGG + Intronic
910256397 1:85251785-85251807 GAGGAAAAGATCTCTACTAACGG + Intronic
910547431 1:88433585-88433607 GAGGAACACACCACCATGAAGGG + Intergenic
911567576 1:99481583-99481605 GAGGCACATACCACCACAAGGGG - Intergenic
911584348 1:99673068-99673090 AAGGAAAATTCCTCCACAAAAGG + Intronic
913534532 1:119758606-119758628 GAGGGAAATTCCAAAACTAAAGG + Intronic
917033920 1:170725652-170725674 GATGAAAAGGCAACCACTAAAGG - Intronic
917986392 1:180324315-180324337 GAGAAAACTACCTTCACTAAAGG - Intronic
920078517 1:203354727-203354749 GAGGTAGAAACCTCCACTAAAGG - Intergenic
920161678 1:204003319-204003341 GGGGAAAATACCACCATTATCGG - Intergenic
920967376 1:210712217-210712239 AAGGCAAATATCACCACTCATGG - Intronic
921791765 1:219298402-219298424 TATGAAAACACGACCACTAAAGG + Intergenic
923538103 1:234868626-234868648 GGGGAAAATACCAGCACTTCTGG - Intergenic
1064080957 10:12307696-12307718 AAAGAAAACACCACCACCAACGG - Intergenic
1064205187 10:13317338-13317360 GAGGAAAACACCAGCTCTCACGG + Intergenic
1068744492 10:60514752-60514774 GAAGAAAATAGAACCACTAAAGG + Intronic
1071296089 10:84221041-84221063 GAGGAAATGACCACCTCTCATGG + Intronic
1076215400 10:128689204-128689226 GAAGGTAAGACCACCACTAAGGG + Intergenic
1078472270 11:11600216-11600238 GAGACAAAGAGCACCACTAAAGG - Intronic
1078996459 11:16705610-16705632 GAGCAAAATCCCACCTCTAGGGG + Intronic
1080682573 11:34490232-34490254 GAGGAAATTATCACCTCTCAGGG - Intronic
1084397526 11:68923070-68923092 TAGGAAAACACAACCACTCAAGG - Intronic
1085293185 11:75414811-75414833 GATGAAAACACCACCATTAGCGG + Intronic
1088321981 11:108563728-108563750 CAGTAAAAAACCACCACTGAAGG + Intronic
1088846372 11:113671821-113671843 GGGGATAATACCACCCTTAAAGG - Intergenic
1088935704 11:114398085-114398107 GTGGAAAATACCACCTCAAAAGG - Intronic
1090084405 11:123638675-123638697 GAGGATAATAACACCAGTCAGGG + Intronic
1090228629 11:125086222-125086244 GAGGAAAATACTATCACTGGTGG - Exonic
1090958218 11:131532978-131533000 GAACAAAATGTCACCACTAAAGG + Intronic
1099575194 12:84370667-84370689 TAGAAAAATACCACAAATAAAGG - Intergenic
1099619405 12:84982230-84982252 GATAAAAATATCACCACTGATGG + Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1111085749 13:83373451-83373473 GAGGAACTTGCCACCATTAAGGG - Intergenic
1113022008 13:105897538-105897560 GAGGAACATAGCACTACTGAGGG + Intergenic
1116539833 14:46087914-46087936 AAGGAAAATAACGTCACTAATGG - Intergenic
1116961183 14:50969814-50969836 CAGGCACATACCACCACTACTGG - Intergenic
1117365788 14:55026339-55026361 AAGGGAAATAGCATCACTAAAGG + Intronic
1117504255 14:56386361-56386383 GAGGAAATCACCCTCACTAAAGG - Intergenic
1117975532 14:61292927-61292949 AAGAAAAATACCACCAAGAAGGG + Intronic
1119398984 14:74349192-74349214 AAGGAAATTCCCACCACCAAGGG - Intronic
1120669710 14:87349807-87349829 GGAGAAAATACAACCACAAAAGG + Intergenic
1122639474 14:103149808-103149830 GAGATTAATGCCACCACTAAAGG - Intergenic
1127453104 15:59135443-59135465 GAGGAAGATACCACCAGAACTGG - Exonic
1127591684 15:60431406-60431428 GAGGAAGATATTACCACAAAAGG + Intronic
1131190017 15:90307248-90307270 GAGGATAATAACACAGCTAAAGG + Intronic
1131742954 15:95414247-95414269 AATGATAATACCACCACTATGGG + Intergenic
1132095918 15:98984824-98984846 GACGAAAATACCACCAAGAAGGG + Intronic
1134842268 16:17411300-17411322 GAAGAAACTACCACCATGAAGGG - Intronic
1135865994 16:26102470-26102492 GAAGAAAATGGCACCACGAAGGG - Intronic
1140280886 16:73554685-73554707 CAGGAAAATATGACCACCAACGG - Intergenic
1143940879 17:10540149-10540171 GAGGAAACTACCAGTGCTAATGG + Intronic
1148293810 17:46481401-46481423 AAGCAAAATAACACCAATAATGG - Intergenic
1148315994 17:46699104-46699126 AAGCAAAATAACACCAATAATGG - Intronic
1149235108 17:54580543-54580565 GAGGAAATTACCTTCACTAAAGG + Intergenic
1149550920 17:57538709-57538731 GAGGAAAAAACAACCACGAAAGG - Intronic
1152142627 17:78546464-78546486 AAGCAAAATACCACAACAAAGGG - Intronic
1152593748 17:81228213-81228235 AATGAAAATACCATCAATAAGGG - Intergenic
1153820562 18:8828042-8828064 GAGGAAAATTCCAACAGAAATGG - Intronic
1154201669 18:12304861-12304883 GTTGAAAATAACACCACTCACGG + Intergenic
1155777844 18:29790936-29790958 GAGGAAAATGCCACCACACCGGG + Intergenic
1157406791 18:47428505-47428527 GAGGAGCATTCCACCACAAACGG - Intergenic
1159032832 18:63248748-63248770 GTAGACAATGCCACCACTAATGG + Intronic
1159406623 18:68010936-68010958 GAGGAAAACAGCACCACCAAAGG - Intergenic
1160109622 18:76013866-76013888 GAGGAAAATACAGACACTGAAGG - Intergenic
1161921526 19:7269752-7269774 GAGGCAAAGACCATCACTCAAGG + Intronic
1162467062 19:10848704-10848726 GAAGAAAAAACCAACACTACTGG - Intronic
1164124042 19:22294005-22294027 GATGAAAATACCAAAAGTAATGG - Intronic
927815879 2:26216882-26216904 GAGGAAAGAACCACCATAAAAGG + Intronic
931357621 2:61550861-61550883 GAGGAAAAGAGGACCACTAAAGG + Intergenic
931568795 2:63646099-63646121 GAGAAAATTACCTTCACTAAAGG - Intronic
939137137 2:138310729-138310751 GAGGGAAATAAAACCACCAAGGG + Intergenic
939432703 2:142131154-142131176 CAGGAAAATACCACCGCGAACGG + Exonic
942980013 2:182069495-182069517 GAGGAAAATACCAGCAAGTATGG + Intronic
943523617 2:188988145-188988167 GAGGAAGAAAACACCACCAATGG - Intronic
945429056 2:209743211-209743233 TAGGAAAATTCCACCACGCAAGG - Intergenic
945895854 2:215480767-215480789 GATGAAAATATCACCCGTAAAGG + Intergenic
1170448486 20:16456365-16456387 AAGAAAAATACCACCAGAAAAGG + Intronic
1173653222 20:44680960-44680982 CAGGAACATACCACCACTCCCGG + Intergenic
1173875760 20:46370369-46370391 CTGGAAAAAACCACCACCAATGG + Intronic
1174013057 20:47466165-47466187 GATAAATATACCACCACAAATGG - Intergenic
1174799700 20:53553105-53553127 AAAAAAAATCCCACCACTAATGG + Intergenic
1175155523 20:56968450-56968472 GAGGAAAATAGAAACACTATGGG - Intergenic
1177179373 21:17728114-17728136 GAAGAAAATACCACCACGTTGGG - Intergenic
1178248447 21:30976779-30976801 GAGGAAATTACCAGAACTAGGGG + Intergenic
1182564301 22:31185768-31185790 GAGGATAAAACCAACACCAAGGG - Intronic
1182878517 22:33713035-33713057 GAGCAAAATCCCATCACTGAAGG + Intronic
1184223183 22:43113706-43113728 GGGGAAAATACCACCAGCAGTGG - Intronic
949629204 3:5904258-5904280 GAGGAAAATCCTGCCTCTAAAGG + Intergenic
958833836 3:99120546-99120568 GAGGGAAATACCCCTACTAAAGG + Intergenic
959487209 3:106940643-106940665 GAAGAAAATACCAGCACAAGAGG - Intergenic
960008767 3:112810493-112810515 GAGAAATATATGACCACTAAAGG - Intronic
960082863 3:113559779-113559801 AAGAAAAAAACCACCACCAATGG - Intronic
963365268 3:144326030-144326052 GAGAAAATTACCTTCACTAAAGG + Intergenic
963709856 3:148734812-148734834 GAGGCAAATACAACCTGTAAAGG + Intronic
964298277 3:155258335-155258357 GAGGAAAATAGCAACATTACAGG + Intergenic
965236674 3:166133843-166133865 GAGAAAATTACCTTCACTAATGG - Intergenic
970471115 4:16380221-16380243 CAGGAACATTCCACCAGTAAGGG - Intergenic
970595369 4:17595403-17595425 GATGGAGATACCACCACTATGGG - Exonic
977983565 4:103355626-103355648 GAGGAAAAAACAAATACTAATGG + Intergenic
978464220 4:108990608-108990630 AAGTAAAGTACCACCTCTAAGGG + Intronic
978804361 4:112785005-112785027 GAGGAAAATACCAGAAGTATGGG + Intergenic
979944514 4:126812261-126812283 CAGGAAAATAATACCACTAGGGG + Intergenic
980234681 4:130090345-130090367 GAGGAAATAACCAGCAGTAAAGG - Intergenic
981320095 4:143381628-143381650 GAGCAAAATACCACCTCCCAGGG - Intronic
981559298 4:146029521-146029543 GAGGAAAATAAAACAACTAAAGG - Intergenic
982125500 4:152180575-152180597 GAGGAAATGACCATCATTAAGGG + Intergenic
982804630 4:159748517-159748539 GAGAAAAAAACCTCCACTCAGGG - Intergenic
985616862 5:927908-927930 GAGTGAAATTCCAACACTAAAGG - Intergenic
991465764 5:66910612-66910634 CAGGAAAATACCACACCAAATGG + Intronic
991620179 5:68536639-68536661 AAGAAAAATATCACCAGTAATGG - Intergenic
992141110 5:73798021-73798043 AAAGAAAACACCACCACAAAGGG - Intronic
992213163 5:74500754-74500776 TAGGAAAATACCACCAATCACGG + Intergenic
993618702 5:90143142-90143164 GAGGAAAATATCAGCATTAAGGG + Intergenic
993692618 5:91021346-91021368 GAGAAAAATAATACCACCAAGGG - Intronic
994740273 5:103609723-103609745 GAGGAAAATACAACTTGTAAAGG + Intergenic
994756926 5:103805180-103805202 GGGGAAAAAACGACCACGAAGGG + Intergenic
995483086 5:112612206-112612228 GTGGAAAATGCCACCATTCAGGG + Intergenic
1003307989 6:4946384-4946406 GAGGAAAATGCCCCCACTGGGGG - Intronic
1004461160 6:15837506-15837528 GAAGAAAATTTCACCACCAATGG - Intergenic
1005326412 6:24705774-24705796 GAGGCAAAAACCAGCACAAATGG + Exonic
1006660325 6:35636675-35636697 GTGGAAAATACCATGACTACTGG + Intronic
1006841224 6:37028981-37029003 GAGCAAACTACCACAACCAATGG + Exonic
1008105655 6:47438640-47438662 GAGGATAAAACCAACACTAGAGG + Intergenic
1008215316 6:48780926-48780948 GAGAAAAACACCTTCACTAAAGG + Intergenic
1008303840 6:49876196-49876218 GAAAAAAACACCACCAATAAAGG + Intronic
1009316432 6:62226572-62226594 GAGGAAAACACCAAAAGTAATGG - Intronic
1011123065 6:83976350-83976372 GTTGAAAATACCACCTTTAAAGG - Intergenic
1012172510 6:96036549-96036571 GGGGAAGTTACCACCGCTAAAGG - Intronic
1012256251 6:97036397-97036419 GGGAAACATAACACCACTAAAGG - Intronic
1013477728 6:110524846-110524868 GAAGAAAATAGCAGCAATAATGG + Intergenic
1017896527 6:158684859-158684881 GAGGAAAAAACTAATACTAAGGG + Intronic
1021228393 7:18055762-18055784 GATGAAAATATTACTACTAATGG - Intergenic
1021495818 7:21273548-21273570 CAGGTACATACCACCACTAGTGG + Intergenic
1022193270 7:28038102-28038124 GAAGAAAATACCAGAACCAATGG + Intronic
1023356104 7:39368843-39368865 GGTGAAAATAACAACACTAAGGG + Intronic
1024621764 7:51165033-51165055 GAGAAAAACACCTTCACTAAAGG + Intronic
1028079318 7:86554033-86554055 GAGTAAAATACCAAAACCAATGG + Intergenic
1031764374 7:125759301-125759323 GAGGAAAATAATATTACTAAAGG + Intergenic
1031915817 7:127561959-127561981 ATAGAAACTACCACCACTAAAGG + Intergenic
1032140069 7:129320769-129320791 GAGGAAAATACCACCACTAATGG - Intronic
1033061556 7:138113919-138113941 GAGGGAAATACATCCACTACAGG + Intronic
1033582262 7:142748918-142748940 AATGAAAATTCCAACACTAAGGG - Intergenic
1034835683 7:154350081-154350103 TAGGACAAAACCACCACCAAGGG + Intronic
1040957294 8:52992455-52992477 CAGGCCAATACCTCCACTAAGGG + Intergenic
1041394890 8:57380157-57380179 TATGAAATTACCATCACTAAAGG + Intergenic
1045250104 8:100475843-100475865 GAGGAAGATGCCACCACTGTGGG + Intergenic
1050532385 9:6601765-6601787 CAGGAGCATACCACCACTGACGG + Intronic
1054991608 9:71333927-71333949 GAGGAAAATAACACATCTGAAGG + Intronic
1055243537 9:74214721-74214743 GAGAAAATTACCTTCACTAAAGG - Intergenic
1055386715 9:75771040-75771062 GAGGAAAAAAACAGCACAAAAGG - Intergenic
1055835096 9:80430715-80430737 GAGGCAAAATGCACCACTAAGGG + Intergenic
1056949040 9:91027285-91027307 GAGGAAAATTAGACCACTCAGGG - Intergenic
1059788591 9:117614715-117614737 TCTGAAAATAGCACCACTAAAGG - Intergenic
1060798964 9:126531813-126531835 GAGGAGAATACCACTTCTCAAGG + Intergenic
1061325992 9:129864917-129864939 GAGAAAAACACCACCACCAATGG - Intronic
1061700362 9:132410671-132410693 GATGATAATGGCACCACTAAAGG + Intronic
1187964235 X:24595056-24595078 TAGGAAAATACGATCACTCATGG + Intronic
1188095282 X:26013801-26013823 GAGGGGAAAAACACCACTAAAGG + Intergenic
1188416529 X:29941967-29941989 GAGGAAAATACCTACAGTATTGG - Intronic
1192082152 X:68058766-68058788 GGGGACAATACCACCATTGAAGG - Intronic
1192674814 X:73184772-73184794 GAAGAAACTACATCCACTAATGG + Intergenic
1193909323 X:87281901-87281923 GAGGAAATCACCTTCACTAAAGG - Intergenic
1194691418 X:96990720-96990742 GAGGAAGCTAATACCACTAAGGG + Intronic
1194929595 X:99869624-99869646 GAGAAAAACACCTTCACTAAAGG + Intergenic
1197452364 X:126635707-126635729 GAGAAAACTACCTTCACTAACGG - Intergenic
1198865184 X:141114881-141114903 GAAGAAAATACCAACACTACAGG + Intergenic
1199806910 X:151309212-151309234 GAGGAAAATACCAGGTCTGAGGG + Intergenic
1201546648 Y:15172275-15172297 AAGGAAAAGAAAACCACTAAGGG - Intergenic
1202595663 Y:26536973-26536995 GAGAAAATTACCTTCACTAATGG + Intergenic